Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803418306:

Variant ID: vg0803418306 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 3418306
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAAAGTTTTTTTTGGTTGAGGGCAATACAAACAAGGAGGATGCATGCGCGTGAGAGGAGTTTATAGCAATACAATTAATGGTGAATATCCGATTGGAT[G/A]
TAGAGACGGTAGAGGCCTGATTTATCTTTTTTTTTTAAAAAAAAAACTACTACCTCAACCCCTAAAAGAACGTTGTTTTAGTATAAAGTTTTTACGGATA

Reverse complement sequence

TATCCGTAAAAACTTTATACTAAAACAACGTTCTTTTAGGGGTTGAGGTAGTAGTTTTTTTTTTAAAAAAAAAAGATAAATCAGGCCTCTACCGTCTCTA[C/T]
ATCCAATCGGATATTCACCATTAATTGTATTGCTATAAACTCCTCTCACGCGCATGCATCCTCCTTGTTTGTATTGCCCTCAACCAAAAAAAACTTTTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	13.80%	0.15%	0.00%	NA
All Indica	2759	88.20%	11.50%	0.25%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	88.10%	11.40%	0.50%	0.00%	NA
Indica II	465	94.00%	6.00%	0.00%	0.00%	NA
Indica III	913	87.00%	12.80%	0.22%	0.00%	NA
Indica Intermediate	786	86.40%	13.40%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	45.80%	54.20%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0803418306	G -> A	LOC_Os08g06180.1	upstream_gene_variant ; 4912.0bp to feature; MODIFIER	silent_mutation	Average:61.671; most accessible tissue: Callus, score: 85.82	N	N	N	N
vg0803418306	G -> A	LOC_Os08g06190.1	upstream_gene_variant ; 1135.0bp to feature; MODIFIER	silent_mutation	Average:61.671; most accessible tissue: Callus, score: 85.82	N	N	N	N
vg0803418306	G -> A	LOC_Os08g06200.1	upstream_gene_variant ; 2263.0bp to feature; MODIFIER	silent_mutation	Average:61.671; most accessible tissue: Callus, score: 85.82	N	N	N	N
vg0803418306	G -> A	LOC_Os08g06190-LOC_Os08g06200	intergenic_region ; MODIFIER	silent_mutation	Average:61.671; most accessible tissue: Callus, score: 85.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0803418306	1.27E-06	4.85E-07	mr1310	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	1.32E-06	1.32E-06	mr1359	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	4.28E-06	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	7.60E-06	mr1564	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	4.04E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	1.11E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	9.77E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	3.33E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	1.17E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306	NA	7.96E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251