Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802999703:

Variant ID: vg0802999703 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2999703
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GGCAAACGCACGGTGTCTGAGGCGCTACACGACAGGAGATAGATTCGTGATATCTCCTCGGCGTTAGGGATGCAAGCGATCCTTGAATACTTCAAGCTCT[G/A]
GGAGCTCCTCCGATCGGTGCAGCTGTCTAACGAGCCGGACAAGCTTTCTTGGTGTTGGGAGAACTCGGGGTAGTACTCCTCCCGCTCGGCTTATCGGGTT

Reverse complement sequence

AACCCGATAAGCCGAGCGGGAGGAGTACTACCCCGAGTTCTCCCAACACCAAGAAAGCTTGTCCGGCTCGTTAGACAGCTGCACCGATCGGAGGAGCTCC[C/T]
AGAGCTTGAAGTATTCAAGGATCGCTTGCATCCCTAACGCCGAGGAGATATCACGAATCTATCTCCTGTCGTGTAGCGCCTCAGACACCGTGCGTTTGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.30%	3.40%	0.80%	2.52%	NA
All Indica	2759	88.90%	5.80%	1.16%	4.17%	NA
All Japonica	1512	99.70%	0.10%	0.00%	0.13%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	84.20%	9.20%	1.18%	5.38%	NA
Indica II	465	98.10%	0.90%	0.00%	1.08%	NA
Indica III	913	86.20%	8.10%	1.97%	3.72%	NA
Indica Intermediate	786	90.20%	3.30%	0.89%	5.60%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802999703	G -> A	LOC_Os08g05600.1	downstream_gene_variant ; 1246.0bp to feature; MODIFIER	silent_mutation	Average:57.589; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0802999703	G -> A	LOC_Os08g05610.1	downstream_gene_variant ; 727.0bp to feature; MODIFIER	silent_mutation	Average:57.589; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0802999703	G -> A	LOC_Os08g05600-LOC_Os08g05610	intergenic_region ; MODIFIER	silent_mutation	Average:57.589; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N
vg0802999703	G -> DEL	N	N	silent_mutation	Average:57.589; most accessible tissue: Zhenshan97 panicle, score: 85.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802999703	4.86E-06	2.40E-06	mr1245_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999703	NA	9.45E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999703	NA	2.05E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999703	NA	7.27E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999703	3.12E-06	3.12E-06	mr1652_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251