Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802411059:

Variant ID: vg0802411059 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2411059
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.56, A: 0.43, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTCATCTTATTTAAAAAATTATACAAATATAAAAAAATTGTGCTTAAAGTACTTTAAATAATAAAGTAAGTCACAAATAAAATAAATAATAATTCTA[T/A]
TTTTTTAATAAGATAAATGATCAAATAGTAAAACAAAATATTAAAAATTCTTATAACGGAGGGAGGGCGTACTATACACCGGTGTCGTCAACGCCGTTGA

Reverse complement sequence

TCAACGGCGTTGACGACACCGGTGTATAGTACGCCCTCCCTCCGTTATAAGAATTTTTAATATTTTGTTTTACTATTTGATCATTTATCTTATTAAAAAA[A/T]
TAGAATTATTATTTATTTTATTTGTGACTTACTTTATTATTTAAAGTACTTTAAGCACAATTTTTTTATATTTGTATAATTTTTTAAATAAGATGAGTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.10% 0.53% 0.00% NA
All Indica  2759 60.70% 38.30% 0.91% 0.00% NA
All Japonica  1512 98.60% 1.40% 0.00% 0.00% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 62.40% 35.30% 2.35% 0.00% NA
Indica II  465 39.80% 59.60% 0.65% 0.00% NA
Indica III  913 70.20% 29.60% 0.22% 0.00% NA
Indica Intermediate  786 60.90% 38.30% 0.76% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802411059 T -> A LOC_Os08g04800.1 downstream_gene_variant ; 3281.0bp to feature; MODIFIER silent_mutation Average:82.424; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0802411059 T -> A LOC_Os08g04810.1 downstream_gene_variant ; 995.0bp to feature; MODIFIER silent_mutation Average:82.424; most accessible tissue: Minghui63 root, score: 95.978 N N N N
vg0802411059 T -> A LOC_Os08g04800-LOC_Os08g04810 intergenic_region ; MODIFIER silent_mutation Average:82.424; most accessible tissue: Minghui63 root, score: 95.978 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0802411059 T A -0.02 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802411059 NA 2.33E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 1.56E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 1.63E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 7.32E-08 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 2.49E-07 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 3.25E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 4.99E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 3.85E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 1.82E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 1.29E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 3.36E-07 1.06E-08 mr1739 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 2.49E-07 2.85E-11 mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 2.21E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 1.09E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802411059 NA 2.25E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251