Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802388554:

Variant ID: vg0802388554 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2388554
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTCCACGGTGCGGCCGTCGTGGTGGTAGAGCGGGCAACTGTCTCGCACCTTGTGGAGTGGAATCCCGAGCTGCCTGGCGAGCACGCCGAGCGGGTTGG[T/C]
GTGGATGCCGGTGATGACGCTGCCGCCGAGCTCAACGGCGGCCTGGTCCCCGCCGAGATGAGTGGTGTAGACGCGGCCGCCGGGGCGGGCGCGGCCCTCG

Reverse complement sequence

CGAGGGCCGCGCCCGCCCCGGCGGCCGCGTCTACACCACTCATCTCGGCGGGGACCAGGCCGCCGTTGAGCTCGGCGGCAGCGTCATCACCGGCATCCAC[A/G]
CCAACCCGCTCGGCGTGCTCGCCAGGCAGCTCGGGATTCCACTCCACAAGGTGCGAGACAGTTGCCCGCTCTACCACCACGACGGCCGCACCGTGGACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	4.30%	3.64%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.07%	0.00%	NA
All Japonica	1512	75.90%	13.10%	10.98%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	62.10%	22.40%	15.51%	0.00%	NA
Tropical Japonica	504	94.20%	0.60%	5.16%	0.00%	NA
Japonica Intermediate	241	81.70%	9.50%	8.71%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

QTN in RiceNavi

Rice quantitative trait nucleotides (QTNs) and inferred QTN effects are from Wei et al., Nature Genetics, 2021.

Category	Variant ID	Chrom	Pos	Gene	MSU	RAP	Alt_Allele_Function	Ref_geno	Alt_geno
Heading date	vg0802388554	Chr8	2388554	Hd18	LOC_Os08g04780	Os08g0143400	delaying heading date	T	C

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802388554	T -> C	LOC_Os08g04780.1	missense_variant ; p.Thr225Ala; MODERATE	nonsynonymous_codon ; T225A	Average:92.835; most accessible tissue: Zhenshan97 panicle, score: 96.294	possibly damaging	-1.667	TOLERATED	0.46

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0802388554	T	C	-0.01	0.0	-0.01	0.0	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802388554	1.03E-07	6.74E-09	mr1588_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251