Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802334748:

Variant ID: vg0802334748 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2334748
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCTTATCCTCTCCTCTCCTCTCCTTATTCATTCCCCATCGGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTCTTTCTCCCCC[G/A]
AAACGGCGTGCGGTGGTGGGAAGGAATACTATGGCGGCGGCGGGTCGGAGGCGGCGGTGGTCCGACGGCCCAGCGGCGGTGCCCTCCCCTCTGCCAGATC

Reverse complement sequence

GATCTGGCAGAGGGGAGGGCACCGCCGCTGGGCCGTCGGACCACCGCCGCCTCCGACCCGCCGCCGCCATAGTATTCCTTCCCACCACCGCACGCCGTTT[C/T]
GGGGGAGAAAGAAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGCCGATGGGGAATGAATAAGGAGAGGAGAGGAGAGGATAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.40%	3.30%	6.20%	7.11%	NA
All Indica	2759	82.00%	0.00%	6.20%	11.74%	NA
All Japonica	1512	82.30%	9.90%	7.54%	0.26%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	67.60%	0.00%	10.42%	22.02%	NA
Indica II	465	69.90%	0.20%	12.04%	17.85%	NA
Indica III	913	97.60%	0.00%	0.55%	1.86%	NA
Indica Intermediate	786	82.10%	0.00%	6.11%	11.83%	NA
Temperate Japonica	767	95.70%	0.50%	3.52%	0.26%	NA
Tropical Japonica	504	58.90%	25.80%	15.28%	0.00%	NA
Japonica Intermediate	241	88.40%	6.60%	4.15%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	3.30%	8.89%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802334748	G -> A	LOC_Os08g04660.1	upstream_gene_variant ; 4011.0bp to feature; MODIFIER	silent_mutation	Average:65.478; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802334748	G -> A	LOC_Os08g04670.1	upstream_gene_variant ; 1838.0bp to feature; MODIFIER	silent_mutation	Average:65.478; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802334748	G -> A	LOC_Os08g04680.1	downstream_gene_variant ; 1509.0bp to feature; MODIFIER	silent_mutation	Average:65.478; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802334748	G -> A	LOC_Os08g04690.1	downstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:65.478; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802334748	G -> A	LOC_Os08g04670-LOC_Os08g04680	intergenic_region ; MODIFIER	silent_mutation	Average:65.478; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802334748	G -> DEL	N	N	silent_mutation	Average:65.478; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802334748	NA	2.16E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802334748	4.75E-06	NA	mr1124_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251