Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802263992:

Variant ID: vg0802263992 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2263992
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCATTAGCGTGTGATTAATTAAGTATTAGTTATTTTTTAAAAAAATAAATCAATATGATTTTTTAAGCAACTTTTATAGAGAAACAGTTTTTAAAAAAT[G/A]
AACCGTTTAACAGTTTGGGAAACGTACGTATAAAAAACGAGGCGAGGGGGGTTGGGAAGGAGCTCTTACGAACGAGCTGGACATGACATGGTGCAGCTTG

Reverse complement sequence

CAAGCTGCACCATGTCATGTCCAGCTCGTTCGTAAGAGCTCCTTCCCAACCCCCCTCGCCTCGTTTTTTATACGTACGTTTCCCAAACTGTTAAACGGTT[C/T]
ATTTTTTAAAAACTGTTTCTCTATAAAAGTTGCTTAAAAAATCATATTGATTTATTTTTTTAAAAAATAACTAATACTTAATTAATCACACGCTAATGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.80%	0.11%	0.00%	NA
All Indica	2759	89.60%	10.30%	0.11%	0.00%	NA
All Japonica	1512	91.30%	8.50%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.50%	5.50%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	80.30%	19.50%	0.22%	0.00%	NA
Indica Intermediate	786	92.60%	7.30%	0.13%	0.00%	NA
Temperate Japonica	767	83.40%	16.30%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802263992	G -> A	LOC_Os08g04550.1	upstream_gene_variant ; 1999.0bp to feature; MODIFIER	silent_mutation	Average:70.342; most accessible tissue: Zhenshan97 panicle, score: 91.845	N	N	N	N
vg0802263992	G -> A	LOC_Os08g04560.1	downstream_gene_variant ; 4455.0bp to feature; MODIFIER	silent_mutation	Average:70.342; most accessible tissue: Zhenshan97 panicle, score: 91.845	N	N	N	N
vg0802263992	G -> A	LOC_Os08g04540-LOC_Os08g04550	intergenic_region ; MODIFIER	silent_mutation	Average:70.342; most accessible tissue: Zhenshan97 panicle, score: 91.845	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0802263992	G	A	-0.05	0.0	0.01	0.06	0.02	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802263992	NA	1.68E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	NA	2.33E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	NA	3.90E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	2.00E-06	1.47E-06	mr1425	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	NA	3.55E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	NA	1.84E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	NA	9.99E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802263992	6.92E-06	5.60E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251