Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802245269:

Variant ID: vg0802245269 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2245269
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGCCCTTAGCCGCCGCCGGATACGTACAGTAATTAACTTTTGCTACGATCGATATAGTATACGTACAGTAATTAATTAAGTATGCACATTTACAAAAA[T/A]
AATAATAATAATAACCACACAGAAAAAAAAGTACAGCTTAACTTAAGTTTTGCACAGTTAAAAACTGATCGAAAACTATGCGACGATCGATATCGATCAG

Reverse complement sequence

CTGATCGATATCGATCGTCGCATAGTTTTCGATCAGTTTTTAACTGTGCAAAACTTAAGTTAAGCTGTACTTTTTTTTCTGTGTGGTTATTATTATTATT[A/T]
TTTTTGTAAATGTGCATACTTAATTAATTACTGTACGTATACTATATCGATCGTAGCAAAAGTTAATTACTGTACGTATCCGGCGGCGGCTAAGGGCTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.80% 0.30% 0.00% NA
All Indica  2759 98.40% 1.50% 0.07% 0.00% NA
All Japonica  1512 1.80% 98.10% 0.13% 0.00% NA
Aus  269 64.70% 32.70% 2.60% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.20% 0.13% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 54.40% 42.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802245269 T -> A LOC_Os08g04530-LOC_Os08g04540 intergenic_region ; MODIFIER silent_mutation Average:79.162; most accessible tissue: Minghui63 root, score: 95.142 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0802245269 T A -0.01 0.02 0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802245269 NA 1.32E-56 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 5.47E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 4.35E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 9.15E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 3.79E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 2.02E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 6.31E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 2.68E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 3.58E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 2.94E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 4.53E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 4.51E-78 mr1087_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 3.73E-74 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 2.13E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 2.90E-54 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.09E-24 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.32E-60 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 2.76E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.14E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.05E-51 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 3.01E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 4.16E-34 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.47E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.00E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802245269 NA 1.41E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251