Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802232200:

Variant ID: vg0802232200 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2232200
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAGAATTGCACGTCAATATATTAGCAGGAAAAGAGTTTTTGTTACACAAAGTAATCAGCTAGACTGGCTTATGCCTAAAGGGGGGACTTGAAGCTAG[G/A]
AACTACTACGACGGTTAAAAACGCAACTCCAAACAGCGGGAGGGGGGCAGAGCCACGCTACACTCCCAAGAAATCCCCAAAACAAGTAACACTAGCTAAA

Reverse complement sequence

TTTAGCTAGTGTTACTTGTTTTGGGGATTTCTTGGGAGTGTAGCGTGGCTCTGCCCCCCTCCCGCTGTTTGGAGTTGCGTTTTTAACCGTCGTAGTAGTT[C/T]
CTAGCTTCAAGTCCCCCCTTTAGGCATAAGCCAGTCTAGCTGATTACTTTGTGTAACAAAAACTCTTTTCCTGCTAATATATTGACGTGCAATTCTTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 19.70% 2.14% 7.49% NA
All Indica  2759 53.30% 33.10% 1.12% 12.43% NA
All Japonica  1512 99.50% 0.20% 0.07% 0.20% NA
Aus  269 74.00% 0.00% 24.91% 1.12% NA
Indica I  595 60.70% 38.00% 0.34% 1.01% NA
Indica II  465 80.00% 14.40% 0.86% 4.73% NA
Indica III  913 36.70% 32.20% 1.42% 29.68% NA
Indica Intermediate  786 51.30% 41.60% 1.53% 5.60% NA
Temperate Japonica  767 99.60% 0.10% 0.13% 0.13% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 78.90% 13.30% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802232200 G -> A LOC_Os08g04520.1 downstream_gene_variant ; 477.0bp to feature; MODIFIER silent_mutation Average:42.388; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0802232200 G -> A LOC_Os08g04510-LOC_Os08g04520 intergenic_region ; MODIFIER silent_mutation Average:42.388; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0802232200 G -> DEL N N silent_mutation Average:42.388; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802232200 NA 1.39E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 NA 6.17E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 NA 7.56E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 2.81E-40 1.23E-62 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 5.79E-37 1.43E-63 mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 NA 1.09E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 NA 2.54E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 NA 1.23E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 NA 1.99E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 9.31E-45 9.66E-64 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802232200 1.90E-43 7.35E-72 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251