Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802224907:

Variant ID: vg0802224907 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2224907
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAACGGGCGAGGTCACGAAGCTGAGCGACGTGGTGACCCTCACCAAAACCGTGGGAACTGAAGCTGGAGTTCACTGCCATCTACAATTTTGAAAGAGG[G/A]
AGAAGGATCAGTAACCATTTTAGAAACAAACTATTGAAAATAAGGAAACCAAAAGAAGCCTTAGCTTTTCGCAAGCAGTTTTGAACTTAGTATCCTTAGG

Reverse complement sequence

CCTAAGGATACTAAGTTCAAAACTGCTTGCGAAAAGCTAAGGCTTCTTTTGGTTTCCTTATTTTCAATAGTTTGTTTCTAAAATGGTTACTGATCCTTCT[C/T]
CCTCTTTCAAAATTGTAGATGGCAGTGAACTCCAGCTTCAGTTCCCACGGTTTTGGTGAGGGTCACCACGTCGCTCAGCTTCGTGACCTCGCCCGTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.10%	18.00%	36.01%	8.89%	NA
All Indica	2759	5.00%	30.20%	52.01%	12.76%	NA
All Japonica	1512	97.10%	0.20%	1.26%	1.46%	NA
Aus	269	7.40%	1.50%	76.95%	14.13%	NA
Indica I	595	1.80%	37.50%	38.82%	21.85%	NA
Indica II	465	10.50%	14.80%	60.65%	13.98%	NA
Indica III	913	3.60%	28.50%	61.77%	6.13%	NA
Indica Intermediate	786	5.90%	35.80%	45.55%	12.85%	NA
Temperate Japonica	767	98.20%	0.00%	1.30%	0.52%	NA
Tropical Japonica	504	97.00%	0.20%	0.79%	1.98%	NA
Japonica Intermediate	241	93.80%	0.80%	2.07%	3.32%	NA
VI/Aromatic	96	89.60%	2.10%	7.29%	1.04%	NA
Intermediate	90	46.70%	7.80%	37.78%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802224907	G -> A	LOC_Os08g04510.1	upstream_gene_variant ; 19.0bp to feature; MODIFIER	silent_mutation	Average:16.355; most accessible tissue: Minghui63 young leaf, score: 24.836	N	N	N	N
vg0802224907	G -> A	LOC_Os08g04510-LOC_Os08g04520	intergenic_region ; MODIFIER	silent_mutation	Average:16.355; most accessible tissue: Minghui63 young leaf, score: 24.836	N	N	N	N
vg0802224907	G -> DEL	N	N	silent_mutation	Average:16.355; most accessible tissue: Minghui63 young leaf, score: 24.836	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802224907	NA	2.10E-12	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	1.29E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	7.41E-19	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	1.12E-19	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	2.25E-20	mr1566	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	9.34E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	3.83E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907	NA	1.90E-19	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251