Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802210642:

Variant ID: vg0802210642 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 2210642
Reference Allele: A	Alternative Allele: G,AACG
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTAACTACTCCATTCGTCCTAAAATATAACAACTTAGAATCGGATGTGACATTTTCTATTTTTCAGATTCATATTACTAGAAAATGTCACATCCGAAC[A/G,AACG]
TAAGTTCTTATATTTTGGGGACAAAATAAGTAATTAATTAGCAGATACTATATAGAGCTTGTTTTTTTTTATTGATTCAATCATGTCTCTTCGGCTTATA

Reverse complement sequence

TATAAGCCGAAGAGACATGATTGAATCAATAAAAAAAAACAAGCTCTATATAGTATCTGCTAATTAATTACTTATTTTGTCCCCAAAATATAAGAACTTA[T/C,CGTT]
GTTCGGATGTGACATTTTCTAGTAATATGAATCTGAAAAATAGAAAATGTCACATCCGATTCTAAGTTGTTATATTTTAGGACGAATGGAGTAGTTAACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	18.70%	0.87%	1.06%	AACG: 0.32%
All Indica	2759	67.30%	31.30%	0.65%	0.18%	AACG: 0.54%
All Japonica	1512	99.70%	0.30%	0.00%	0.07%	NA
Aus	269	75.10%	0.00%	8.55%	16.36%	NA
Indica I	595	61.20%	38.70%	0.17%	0.00%	NA
Indica II	465	85.80%	14.00%	0.22%	0.00%	NA
Indica III	913	69.70%	28.10%	0.55%	0.00%	AACG: 1.64%
Indica Intermediate	786	58.40%	39.60%	1.40%	0.64%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802210642	A -> G	LOC_Os08g04490.1	downstream_gene_variant ; 953.0bp to feature; MODIFIER	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0802210642	A -> G	LOC_Os08g04500.1	intron_variant ; MODIFIER	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0802210642	A -> G	LOC_Os08g04500.2	intron_variant ; MODIFIER	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0802210642	A -> AACG	LOC_Os08g04490.1	downstream_gene_variant ; 954.0bp to feature; MODIFIER	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0802210642	A -> AACG	LOC_Os08g04500.1	intron_variant ; MODIFIER	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0802210642	A -> AACG	LOC_Os08g04500.2	intron_variant ; MODIFIER	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0802210642	A -> DEL	N	N	silent_mutation	Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802210642	NA	2.60E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642	1.19E-42	5.03E-67	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642	2.28E-36	1.33E-64	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642	NA	2.87E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642	3.65E-46	1.39E-67	mr1739_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642	5.72E-43	1.20E-75	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251