Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802112147:

Variant ID: vg0802112147 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2112147
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.27, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTGAGTGTACATTGGGACTGTCTGTACATCTCAATATCTCATACAGCAGGAGAAATAATTTCAGGTCCTGCTTAGGATTACATTGCAATCCTGTTCTG[T/C]
TGAACTGCTTCTGATATGCATGGTTTTTGGGCCTCCATCCTGGCCCATCCGTATGTATGGGCCGGTTTTTTGACCTTGGATGTGGCAGGATTTCGGCCTA

Reverse complement sequence

TAGGCCGAAATCCTGCCACATCCAAGGTCAAAAAACCGGCCCATACATACGGATGGGCCAGGATGGAGGCCCAAAAACCATGCATATCAGAAGCAGTTCA[A/G]
CAGAACAGGATTGCAATGTAATCCTAAGCAGGACCTGAAATTATTTCTCCTGCTGTATGAGATATTGAGATGTACAGACAGTCCCAATGTACACTCAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.50% 0.15% 0.00% NA
All Indica  2759 53.40% 46.40% 0.25% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 17.80% 82.20% 0.00% 0.00% NA
Indica I  595 68.20% 31.60% 0.17% 0.00% NA
Indica II  465 81.70% 18.10% 0.22% 0.00% NA
Indica III  913 30.60% 69.40% 0.00% 0.00% NA
Indica Intermediate  786 51.80% 47.60% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802112147 T -> C LOC_Os08g04310.1 upstream_gene_variant ; 3536.0bp to feature; MODIFIER silent_mutation Average:96.442; most accessible tissue: Minghui63 young leaf, score: 98.176 N N N N
vg0802112147 T -> C LOC_Os08g04300.1 downstream_gene_variant ; 13.0bp to feature; MODIFIER silent_mutation Average:96.442; most accessible tissue: Minghui63 young leaf, score: 98.176 N N N N
vg0802112147 T -> C LOC_Os08g04300-LOC_Os08g04310 intergenic_region ; MODIFIER silent_mutation Average:96.442; most accessible tissue: Minghui63 young leaf, score: 98.176 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0802112147 T C 0.05 0.06 0.07 0.05 0.05 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802112147 NA 3.58E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 4.88E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 4.06E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 1.51E-09 2.58E-17 mr1739 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 1.16E-11 5.84E-22 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 6.22E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 7.84E-07 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 8.25E-07 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 1.43E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 2.59E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 8.39E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 NA 1.13E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 1.30E-07 9.55E-19 mr1739_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802112147 3.35E-08 1.29E-17 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251