Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802075324:

Variant ID: vg0802075324 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2075324
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATTTATTTTATTGTGACTTGATTCATCATCAAATGTTCTTTAAGCATAACATAAATATTTTCATATTTGCACAAAATTTTTGAATAAAATGAATGGTC[A/T]
AACGTTGGTTAAAAAGTCAACGGCGTCATACATTAAAATACGGAGGGAGTAGTTCATTTTCTTAAAAAATTGCTACCATATCATCCATATGTGTCATACA

Reverse complement sequence

TGTATGACACATATGGATGATATGGTAGCAATTTTTTAAGAAAATGAACTACTCCCTCCGTATTTTAATGTATGACGCCGTTGACTTTTTAACCAACGTT[T/A]
GACCATTCATTTTATTCAAAAATTTTGTGCAAATATGAAAATATTTATGTTATGCTTAAAGAACATTTGATGATGAATCAAGTCACAATAAAATAAATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 23.70% 0.06% 0.00% NA
All Indica  2759 60.20% 39.70% 0.11% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.90% 31.80% 0.34% 0.00% NA
Indica II  465 85.40% 14.60% 0.00% 0.00% NA
Indica III  913 42.10% 57.80% 0.11% 0.00% NA
Indica Intermediate  786 60.40% 39.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802075324 A -> T LOC_Os08g04270.1 upstream_gene_variant ; 1910.0bp to feature; MODIFIER silent_mutation Average:25.473; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0802075324 A -> T LOC_Os08g04270.2 upstream_gene_variant ; 1910.0bp to feature; MODIFIER silent_mutation Average:25.473; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0802075324 A -> T LOC_Os08g04270.3 upstream_gene_variant ; 1910.0bp to feature; MODIFIER silent_mutation Average:25.473; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0802075324 A -> T LOC_Os08g04260.1 downstream_gene_variant ; 2003.0bp to feature; MODIFIER silent_mutation Average:25.473; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0802075324 A -> T LOC_Os08g04260-LOC_Os08g04270 intergenic_region ; MODIFIER silent_mutation Average:25.473; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802075324 NA 3.24E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 NA 1.49E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 3.67E-12 8.07E-24 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 1.81E-10 9.37E-21 mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 NA 2.86E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 NA 8.42E-07 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 NA 4.32E-06 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 3.04E-08 1.07E-18 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802075324 4.08E-07 4.41E-17 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251