Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802053469:

Variant ID: vg0802053469 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2053469
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGGGCAGCACGAAGTCGAGCGGTGAGGTCGGCTATGAGGAGGCAGCGGTGAGGTGCTCCTGCCGCTCGTGGAGCTCATGGCGGGTGGCGAGGAGGCGG[T/G]
CGGAGAGGCCTAGGGATGAGGAGAGCGGCGCGAGCGCCGAAGCGAGAGAGGAAAGGGGAGAGAGATGAAGAGATGGGAGATGGGGAGAGAGAGGAGGAAG

Reverse complement sequence

CTTCCTCCTCTCTCTCCCCATCTCCCATCTCTTCATCTCTCTCCCCTTTCCTCTCTCGCTTCGGCGCTCGCGCCGCTCTCCTCATCCCTAGGCCTCTCCG[A/C]
CCGCCTCCTCGCCACCCGCCATGAGCTCCACGAGCGGCAGGAGCACCTCACCGCTGCCTCCTCATAGCCGACCTCACCGCTCGACTTCGTGCTGCCCGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.20%	0.30%	0.28%	0.25%	NA
All Indica	2759	98.60%	0.50%	0.47%	0.36%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	0.30%	0.67%	0.50%	NA
Indica II	465	97.00%	0.60%	1.08%	1.29%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	98.70%	0.80%	0.38%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802053469	T -> G	LOC_Os08g04220.1	upstream_gene_variant ; 4459.0bp to feature; MODIFIER	N	Average:80.94; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0802053469	T -> G	LOC_Os08g04210.1	downstream_gene_variant ; 719.0bp to feature; MODIFIER	N	Average:80.94; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N
vg0802053469	T -> G	LOC_Os08g04200-LOC_Os08g04210	intergenic_region ; MODIFIER	N	Average:80.94; most accessible tissue: Minghui63 panicle, score: 94.638	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0802053469	T	G	0.01	0.01	0.0	0.0	0.0	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802053469	8.47E-08	3.97E-10	Heading_date	Ind_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0802053469	NA	1.31E-35	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	3.92E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	2.81E-19	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	5.71E-18	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	1.21E-27	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	1.19E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	4.49E-73	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	2.28E-18	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	5.05E-61	mr1970_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802053469	NA	1.27E-96	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251