Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801983616:

Variant ID: vg0801983616 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1983616
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAATACATCCTCTAAATTATACCTAGAATAATTAAAATCCGTGTGAAAGCCTCCAACAATTAAAAGGTGCAAAGTTAAAAGTCAAATAAGGCTTGGGG[G/A]
ATTTCTGTATATTTCCTAAAAACCTAAAATGCGTAAATAAATTTTAGTGGAATTTTCAGAGCACAAATAATAATTATTAAGAAATAAACAAAGTTAAAAT

Reverse complement sequence

ATTTTAACTTTGTTTATTTCTTAATAATTATTATTTGTGCTCTGAAAATTCCACTAAAATTTATTTACGCATTTTAGGTTTTTAGGAAATATACAGAAAT[C/T]
CCCCAAGCCTTATTTGACTTTTAACTTTGCACCTTTTAATTGTTGGAGGCTTTCACACGGATTTTAATTATTCTAGGTATAATTTAGAGGATGTATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	7.30%	3.75%	23.55%	NA
All Indica	2759	46.10%	12.20%	2.83%	38.89%	NA
All Japonica	1512	99.30%	0.30%	0.13%	0.26%	NA
Aus	269	57.60%	0.00%	33.46%	8.92%	NA
Indica I	595	67.60%	27.90%	0.84%	3.70%	NA
Indica II	465	80.90%	0.60%	1.29%	17.20%	NA
Indica III	913	12.40%	10.30%	4.16%	73.17%	NA
Indica Intermediate	786	48.30%	9.40%	3.69%	38.55%	NA
Temperate Japonica	767	99.10%	0.50%	0.26%	0.13%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	78.90%	3.30%	5.56%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801983616	G -> A	LOC_Os08g04080.1	upstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:26.188; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0801983616	G -> A	LOC_Os08g04090.1	upstream_gene_variant ; 4730.0bp to feature; MODIFIER	silent_mutation	Average:26.188; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0801983616	G -> A	LOC_Os08g04090.2	upstream_gene_variant ; 4688.0bp to feature; MODIFIER	silent_mutation	Average:26.188; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0801983616	G -> A	LOC_Os08g04080-LOC_Os08g04090	intergenic_region ; MODIFIER	silent_mutation	Average:26.188; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0801983616	G -> DEL	N	N	silent_mutation	Average:26.188; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801983616	3.98E-09	3.14E-19	mr1739	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	7.59E-07	9.11E-14	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	NA	7.65E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	8.87E-06	1.40E-16	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	NA	1.23E-12	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	NA	3.22E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	NA	3.44E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801983616	NA	4.05E-06	mr1899_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251