Search for Variation information by Variation ID:
Detailed information for vg0801819951:
| Variant ID: vg0801819951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1819951 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CTCTTACTCTTGCGAGTATCTACAATGTTGTCCTCCTCAGGATTTTCCTTAGGCGTTTGATCATTGTGTTCTATCGGTGCCAAGTGCTCATGGGGCATGA[C/T]
AGTTTCTTTACTAGAAGTGCTAGGTGTATGTTTCATAGGAAATTCATTCTCAAAGAATGTAGCACCTCTGGACTCAAGAATTGTACCAACATGCATGTCA
Reverse complement sequence
TGACATGCATGTTGGTACAATTCTTGAGTCCAGAGGTGCTACATTCTTTGAGAATGAATTTCCTATGAAACATACACCTAGCACTTCTAGTAAAGAAACT[G/A]
TCATGCCCCATGAGCACTTGGCACCGATAGAACACAATGATCAAACGCCTAAGGAAAATCCTGAGGAGGACAACATTGTAGATACTCGCAAGAGTAAGAG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.90% | 29.10% | 0.61% | 27.44% | NA |
| All Indica | 2759 | 14.60% | 45.70% | 0.87% | 38.82% | NA |
| All Japonica | 1512 | 98.30% | 1.40% | 0.00% | 0.33% | NA |
| Aus | 269 | 1.50% | 23.40% | 1.12% | 73.98% | NA |
| Indica I | 595 | 30.90% | 65.20% | 0.50% | 3.36% | NA |
| Indica II | 465 | 2.80% | 74.20% | 0.86% | 22.15% | NA |
| Indica III | 913 | 11.30% | 13.60% | 0.66% | 74.48% | NA |
| Indica Intermediate | 786 | 13.10% | 51.40% | 1.40% | 34.10% | NA |
| Temperate Japonica | 767 | 98.00% | 1.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.80% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 6.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 51.10% | 24.40% | 2.22% | 22.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801819951 | C -> T | LOC_Os08g03810.1 | missense_variant ; p.Val643Ile; MODERATE | nonsynonymous_codon ; V643I | Average:31.991; most accessible tissue: Minghui63 flag leaf, score: 39.69 | benign  |
0.494 |
TOLERATED | 0.81 |
| vg0801819951 | C -> DEL | LOC_Os08g03810.1 | N | frameshift_variant | Average:31.991; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801819951 | 3.30E-08 | 3.00E-12 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | 2.47E-09 | 3.88E-20 | mr1739 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | NA | 5.45E-12 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | NA | 8.27E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | NA | 4.50E-07 | mr1483_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | NA | 1.10E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | NA | 1.45E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801819951 | NA | 4.07E-14 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |