Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801802005:

Variant ID: vg0801802005 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1802005
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGTACACGGTTATTAAGAAAGTAGGTAGAAGAAAGTGGTGGAGGATTGTGACTGGATAAGTAGTGGAGATATGTGGAAAAAGCGAATGGTGGAGGGTT[G/A]
TGATTGATTGGGAATAAAAGTTGTTATATTTTGGGACAAATCCTGAGGGCTAAAAGTTGTTATATTTTTGGACGGAGGGAGTACTATATTTTATAAAATA

Reverse complement sequence

TATTTTATAAAATATAGTACTCCCTCCGTCCAAAAATATAACAACTTTTAGCCCTCAGGATTTGTCCCAAAATATAACAACTTTTATTCCCAATCAATCA[C/T]
AACCCTCCACCATTCGCTTTTTCCACATATCTCCACTACTTATCCAGTCACAATCCTCCACCACTTTCTTCTACCTACTTTCTTAATAACCGTGTACAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.30%	8.70%	0.36%	23.70%	NA
All Indica	2759	49.20%	12.40%	0.58%	37.80%	NA
All Japonica	1512	99.70%	0.10%	0.00%	0.26%	NA
Aus	269	55.80%	22.70%	0.37%	21.19%	NA
Indica I	595	68.60%	27.90%	0.00%	3.53%	NA
Indica II	465	77.40%	0.60%	0.65%	21.29%	NA
Indica III	913	15.80%	10.30%	0.66%	73.27%	NA
Indica Intermediate	786	56.60%	10.20%	0.89%	32.32%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	3.30%	0.00%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801802005	G -> A	LOC_Os08g03780.1	downstream_gene_variant ; 2789.0bp to feature; MODIFIER	silent_mutation	Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg0801802005	G -> A	LOC_Os08g03790.1	downstream_gene_variant ; 736.0bp to feature; MODIFIER	silent_mutation	Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg0801802005	G -> A	LOC_Os08g03790-LOC_Os08g03800	intergenic_region ; MODIFIER	silent_mutation	Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg0801802005	G -> DEL	N	N	silent_mutation	Average:27.372; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801802005	5.07E-07	2.24E-16	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	2.00E-07	3.97E-15	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	NA	2.30E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	5.36E-06	5.84E-19	mr1739_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	NA	5.74E-14	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	NA	1.37E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	NA	7.50E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801802005	NA	6.77E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251