Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801631583:

Variant ID: vg0801631583 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1631583
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

ACACATTTTGGTTTTCCATCGAATTATTATCCAATTCCATATGAATATCGATCTGATCGAACTTGTTTGATTAATCTATTGCAAAATACTTGGAGTCCTC[C/T]
GTGTCGAATGGACCAAATCTCCATATATATAGCCGCATCTACAAACCACTTTTTTATGAGAAAATGTGACACACACACACACTTTGCTTTCCCGTCAAAT

Reverse complement sequence

ATTTGACGGGAAAGCAAAGTGTGTGTGTGTGTCACATTTTCTCATAAAAAAGTGGTTTGTAGATGCGGCTATATATATGGAGATTTGGTCCATTCGACAC[G/A]
GAGGACTCCAAGTATTTTGCAATAGATTAATCAAACAAGTTCGATCAGATCGATATTCATATGGAATTGGATAATAATTCGATGGAAAACCAAAATGTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	7.40%	0.08%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.04%	0.00%	NA
All Japonica	1512	94.50%	5.30%	0.20%	0.00%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.30%	0.13%	0.00%	NA
Temperate Japonica	767	94.30%	5.60%	0.13%	0.00%	NA
Tropical Japonica	504	93.50%	6.30%	0.20%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801631583	C -> T	LOC_Os08g03460.1	upstream_gene_variant ; 4094.0bp to feature; MODIFIER	silent_mutation	Average:30.408; most accessible tissue: Callus, score: 50.335	N	N	N	N
vg0801631583	C -> T	LOC_Os08g03480.1	upstream_gene_variant ; 655.0bp to feature; MODIFIER	silent_mutation	Average:30.408; most accessible tissue: Callus, score: 50.335	N	N	N	N
vg0801631583	C -> T	LOC_Os08g03490.1	upstream_gene_variant ; 2920.0bp to feature; MODIFIER	silent_mutation	Average:30.408; most accessible tissue: Callus, score: 50.335	N	N	N	N
vg0801631583	C -> T	LOC_Os08g03470.1	downstream_gene_variant ; 410.0bp to feature; MODIFIER	silent_mutation	Average:30.408; most accessible tissue: Callus, score: 50.335	N	N	N	N
vg0801631583	C -> T	LOC_Os08g03470-LOC_Os08g03480	intergenic_region ; MODIFIER	silent_mutation	Average:30.408; most accessible tissue: Callus, score: 50.335	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801631583	5.45E-07	NA	mr1037	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801631583	6.22E-06	NA	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801631583	NA	6.21E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801631583	NA	2.67E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251