Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801178662:

Variant ID: vg0801178662 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1178662
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGTAAAAAATGAACCCGAACAATAATTGTGTTCGATTTTTAAAATCCCAATAACAATAAAGAGAAAAAACAGTGGACGGTCCATAGAGGAGTATAATG[G/A]
CAGCGTTTGACGAGACTTCTAGAAATTATAAAAACGAAACCCAACGAGATAATAAACTGTAAAAACTATAAGATCCAATTTTTGAAGATACCAAGGAGAA

Reverse complement sequence

TTCTCCTTGGTATCTTCAAAAATTGGATCTTATAGTTTTTACAGTTTATTATCTCGTTGGGTTTCGTTTTTATAATTTCTAGAAGTCTCGTCAAACGCTG[C/T]
CATTATACTCCTCTATGGACCGTCCACTGTTTTTTCTCTTTATTGTTATTGGGATTTTAAAAATCGAACACAATTATTGTTCGGGTTCATTTTTTACTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	13.80%	0.91%	21.98%	NA
All Indica	2759	70.80%	0.50%	0.72%	28.02%	NA
All Japonica	1512	58.30%	40.90%	0.33%	0.40%	NA
Aus	269	5.60%	0.00%	6.32%	88.10%	NA
Indica I	595	69.60%	1.20%	1.18%	28.07%	NA
Indica II	465	95.10%	0.00%	0.00%	4.95%	NA
Indica III	913	53.70%	0.10%	0.77%	45.45%	NA
Indica Intermediate	786	77.10%	0.80%	0.76%	21.37%	NA
Temperate Japonica	767	75.90%	23.70%	0.26%	0.13%	NA
Tropical Japonica	504	22.60%	76.80%	0.00%	0.60%	NA
Japonica Intermediate	241	77.20%	20.70%	1.24%	0.83%	NA
VI/Aromatic	96	90.60%	2.10%	0.00%	7.29%	NA
Intermediate	90	61.10%	20.00%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801178662	G -> A	LOC_Os08g02790.1	upstream_gene_variant ; 2264.0bp to feature; MODIFIER	silent_mutation	Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N
vg0801178662	G -> A	LOC_Os08g02800.1	upstream_gene_variant ; 658.0bp to feature; MODIFIER	silent_mutation	Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N
vg0801178662	G -> A	LOC_Os08g02810.1	upstream_gene_variant ; 2772.0bp to feature; MODIFIER	silent_mutation	Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N
vg0801178662	G -> A	LOC_Os08g02820.1	downstream_gene_variant ; 4069.0bp to feature; MODIFIER	silent_mutation	Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N
vg0801178662	G -> A	LOC_Os08g02790-LOC_Os08g02800	intergenic_region ; MODIFIER	silent_mutation	Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N
vg0801178662	G -> DEL	N	N	silent_mutation	Average:32.014; most accessible tissue: Zhenshan97 flower, score: 45.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801178662	NA	2.51E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662	1.55E-08	NA	mr1107_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662	NA	4.08E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662	NA	8.23E-09	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801178662	NA	1.28E-06	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251