Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801160172:

Variant ID: vg0801160172 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1160172
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

AACAAACTTTTAAATTCAGGATTTAAAACTTTCAACTTATGTTTGAAAACTTGTAAGCCAAGATTTGAAACTTTCAACTCAATATTTTTTAAAATTTTCA[T/A]
CTCAGATTTTAAAATTCTCAAGTGAAGACCTAAAAACTTTTAATTCAGATTTGAAAACTTTCAACTCGGATTTGAAAACTTTCTGTTCAGTCTTGAAAAG

Reverse complement sequence

CTTTTCAAGACTGAACAGAAAGTTTTCAAATCCGAGTTGAAAGTTTTCAAATCTGAATTAAAAGTTTTTAGGTCTTCACTTGAGAATTTTAAAATCTGAG[A/T]
TGAAAATTTTAAAAAATATTGAGTTGAAAGTTTCAAATCTTGGCTTACAAGTTTTCAAACATAAGTTGAAAGTTTTAAATCCTGAATTTAAAAGTTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	9.80%	17.35%	22.68%	NA
All Indica	2759	27.00%	14.60%	26.06%	32.26%	NA
All Japonica	1512	97.70%	0.10%	0.46%	1.79%	NA
Aus	269	2.60%	21.20%	27.51%	48.70%	NA
Indica I	595	14.30%	13.80%	29.24%	42.69%	NA
Indica II	465	15.70%	11.60%	21.51%	51.18%	NA
Indica III	913	33.70%	18.50%	29.90%	17.85%	NA
Indica Intermediate	786	35.60%	12.60%	21.88%	29.90%	NA
Temperate Japonica	767	97.00%	0.10%	0.78%	2.09%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	97.50%	0.00%	0.41%	2.07%	NA
VI/Aromatic	96	88.50%	0.00%	5.21%	6.25%	NA
Intermediate	90	62.20%	1.10%	16.67%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801160172	T -> A	LOC_Os08g02770.1	upstream_gene_variant ; 4805.0bp to feature; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Callus, score: 41.046	N	N	N	N
vg0801160172	T -> A	LOC_Os08g02750.1	downstream_gene_variant ; 3744.0bp to feature; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Callus, score: 41.046	N	N	N	N
vg0801160172	T -> A	LOC_Os08g02760.1	downstream_gene_variant ; 2071.0bp to feature; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Callus, score: 41.046	N	N	N	N
vg0801160172	T -> A	LOC_Os08g02750-LOC_Os08g02760	intergenic_region ; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Callus, score: 41.046	N	N	N	N
vg0801160172	T -> DEL	N	N	silent_mutation	Average:11.467; most accessible tissue: Callus, score: 41.046	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801160172	NA	2.38E-15	mr1216_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801160172	NA	5.95E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801160172	NA	2.88E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251