Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800453306:

Variant ID: vg0800453306 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 453306
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTATATCTCCCAACTTTCATCTGACCTGTGCAAATATTCATAAATAAATATGCTACAACTATTTTTGAAATTATGCGTACTACATACTAGCATAAT[A/G]
TATTTTCCATTTGATTTTCCAGGTCAAGCTATCAATATTTGGCAGGGAGCTAAATGTTGTTCTCATTTCTAGAAGATCACGGCATTTTGCAGGGACACGG

Reverse complement sequence

CCGTGTCCCTGCAAAATGCCGTGATCTTCTAGAAATGAGAACAACATTTAGCTCCCTGCCAAATATTGATAGCTTGACCTGGAAAATCAAATGGAAAATA[T/C]
ATTATGCTAGTATGTAGTACGCATAATTTCAAAAATAGTTGTAGCATATTTATTTATGAATATTTGCACAGGTCAGATGAAAGTTGGGAGATATAATTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 18.60% 0.30% 0.06% NA
All Indica  2759 78.00% 21.50% 0.40% 0.11% NA
All Japonica  1512 98.50% 1.50% 0.07% 0.00% NA
Aus  269 7.80% 92.20% 0.00% 0.00% NA
Indica I  595 63.20% 35.60% 1.18% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 83.60% 16.20% 0.11% 0.11% NA
Indica Intermediate  786 74.20% 25.30% 0.25% 0.25% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800453306 A -> G LOC_Os08g01740.1 downstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800453306 A -> G LOC_Os08g01740.2 downstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800453306 A -> G LOC_Os08g01750.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800453306 A -> G LOC_Os08g01750.3 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800453306 A -> G LOC_Os08g01750.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800453306 A -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800453306 NA 2.12E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 2.03E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 2.27E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 5.69E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 7.60E-07 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 7.81E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 8.57E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 2.12E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 3.66E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 9.43E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 8.05E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 2.66E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 1.75E-06 NA mr1746 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 1.82E-06 2.32E-08 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 4.08E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 9.36E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 NA 4.10E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 5.04E-07 NA mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800453306 5.12E-09 1.71E-10 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251