Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800307583:

Variant ID: vg0800307583 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 307583
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCCTCTCCTCCTAGGGGGTTTTGTATTTATACCCATAGGTATCTCCTTGTCCAAGTAGAACTAGGGAAACTAATATGGATACAATCCGAGTAGTCCTG[G/A]
TCGTTTCCATGTAAAACTCTGGTTGTCTTTCTTTATCCGGAACTCCCTCCATATCCGCAGGTTGTTTCCGTATAGGACATGGTATGTGGTGGGCCCTGCC

Reverse complement sequence

GGCAGGGCCCACCACATACCATGTCCTATACGGAAACAACCTGCGGATATGGAGGGAGTTCCGGATAAAGAAAGACAACCAGAGTTTTACATGGAAACGA[C/T]
CAGGACTACTCGGATTGTATCCATATTAGTTTCCCTAGTTCTACTTGGACAAGGAGATACCTATGGGTATAAATACAAAACCCCCTAGGAGGAGAGGGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	32.80%	1.78%	0.15%	NA
All Indica	2759	44.50%	54.40%	0.83%	0.22%	NA
All Japonica	1512	98.50%	1.50%	0.07%	0.00%	NA
Aus	269	77.70%	0.70%	21.19%	0.37%	NA
Indica I	595	34.10%	65.20%	0.67%	0.00%	NA
Indica II	465	19.40%	79.40%	0.65%	0.65%	NA
Indica III	913	63.30%	35.90%	0.77%	0.00%	NA
Indica Intermediate	786	45.40%	53.10%	1.15%	0.38%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.40%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	2.10%	3.12%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800307583	G -> A	LOC_Os08g01490.1	upstream_gene_variant ; 3527.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307583	G -> A	LOC_Os08g01500.1	upstream_gene_variant ; 125.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307583	G -> A	LOC_Os08g01510.1	upstream_gene_variant ; 745.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307583	G -> A	LOC_Os08g01500-LOC_Os08g01510	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800307583	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800307583	1.27E-06	NA	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	5.53E-07	3.88E-10	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	NA	4.77E-12	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	5.04E-08	NA	mr1746	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	1.25E-09	6.51E-11	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	3.32E-07	NA	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	7.75E-08	1.44E-10	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	NA	3.74E-07	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	3.36E-08	NA	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800307583	1.00E-09	1.24E-12	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251