Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800300760:

Variant ID: vg0800300760 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 300760
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTCCCTCCTCCCTCTTCGGGCCGCCGGCCCAGCTCTTTCGCTCCTCCCTCGACGCAAAGTCTATTAGGCCTCCCTCCTCTCAATTTAAATAATTTTT[T/C]
GGGTAGTAAATAATTTTAAATGAAAAAATTGTCAACAAGAAAGTTATATAACTTATCAAGATCTACAACTTTTGTTTTGGTCATTTTGCTATATGACTTT

Reverse complement sequence

AAAGTCATATAGCAAAATGACCAAAACAAAAGTTGTAGATCTTGATAAGTTATATAACTTTCTTGTTGACAATTTTTTCATTTAAAATTATTTACTACCC[A/G]
AAAAATTATTTAAATTGAGAGGAGGGAGGCCTAATAGACTTTGCGTCGAGGGAGGAGCGAAAGAGCTGGGCCGGCGGCCCGAAGAGGGAGGAGGGAAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 47.80% 0.21% 0.17% NA
All Indica  2759 38.70% 61.00% 0.25% 0.00% NA
All Japonica  1512 86.60% 12.80% 0.07% 0.53% NA
Aus  269 5.20% 94.80% 0.00% 0.00% NA
Indica I  595 57.80% 42.00% 0.17% 0.00% NA
Indica II  465 20.20% 79.80% 0.00% 0.00% NA
Indica III  913 37.10% 62.70% 0.22% 0.00% NA
Indica Intermediate  786 37.20% 62.30% 0.51% 0.00% NA
Temperate Japonica  767 96.90% 2.60% 0.00% 0.52% NA
Tropical Japonica  504 70.80% 29.00% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 11.20% 0.00% 1.66% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800300760 T -> C LOC_Os08g01480.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800300760 T -> C LOC_Os08g01490.1 downstream_gene_variant ; 882.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800300760 T -> C LOC_Os08g01480-LOC_Os08g01490 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800300760 T -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800300760 T C -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800300760 5.82E-08 1.24E-15 mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 5.32E-09 1.14E-08 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 2.08E-21 2.43E-36 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 1.28E-18 5.70E-25 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 NA 2.10E-12 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 NA 8.90E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 1.65E-10 1.18E-19 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 7.76E-11 9.06E-08 mr1277_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 3.85E-06 NA mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 NA 2.31E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 8.70E-06 NA mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 3.53E-25 1.15E-47 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 1.85E-22 3.04E-31 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 1.52E-06 3.09E-12 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800300760 NA 6.29E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251