Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800237681:

Variant ID: vg0800237681 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 237681
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATCCTCGCATTGCGGGTCTTCGGGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACGGCGAAAAATAAAGCCCTATTATTGACCTCTAAGC[G/A]
TGCCATTAGATAGATCTCGAGATTTGAGGAATTTTGGAAGTTGAACGGAGTCAAACGGTCATACGGTTGAGAAGATATTGAATTTCTAAGATTATTGGAT

Reverse complement sequence

ATCCAATAATCTTAGAAATTCAATATCTTCTCAACCGTATGACCGTTTGACTCCGTTCAACTTCCAAAATTCCTCAAATCTCGAGATCTATCTAATGGCA[C/T]
GCTTAGAGGTCAATAATAGGGCTTTATTTTTCGCCGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCCCGAAGACCCGCAATGCGAGGATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.00% 20.90% 0.04% 0.00% NA
All Indica  2759 67.80% 32.20% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 75.00% 25.00% 0.00% 0.00% NA
Indica II  465 88.20% 11.80% 0.00% 0.00% NA
Indica III  913 47.40% 52.60% 0.00% 0.00% NA
Indica Intermediate  786 73.90% 26.00% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 79.20% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800237681 G -> A LOC_Os08g01370.1 upstream_gene_variant ; 3258.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800237681 G -> A LOC_Os08g01380.1 downstream_gene_variant ; 3998.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800237681 G -> A LOC_Os08g01380.2 downstream_gene_variant ; 3998.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800237681 G -> A LOC_Os08g01370-LOC_Os08g01380 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800237681 2.21E-06 NA mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 3.13E-09 7.81E-13 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 5.15E-09 1.99E-11 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 NA 7.96E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 2.95E-06 2.96E-06 mr1366 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 4.35E-14 1.08E-24 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 1.11E-12 6.37E-16 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 6.56E-06 6.54E-06 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 2.10E-06 2.10E-06 mr1883 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 1.89E-08 NA mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 3.47E-08 5.74E-11 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 1.41E-12 1.51E-26 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800237681 1.68E-11 2.14E-18 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251