Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800225034:

Variant ID: vg0800225034 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 225034
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTAGATCCCAGGTAGATCCAGGGCAGATGGGGGGCAAGAAGGCTATAAGAAAGAAACCGACCTTCCAGTCGACGGCGTGGAAGAAGCCGAGGAAGGAG[T/A]
CGAGGGCGGGGCGGAATCCGGAGCGGAGGTCGGAGGAGACGCGCCCAAAGAGCTCCGCCACCACGTCGGCGTGCTCGTTCAGCGCCTCCCGCACCTCACC

Reverse complement sequence

GGTGAGGTGCGGGAGGCGCTGAACGAGCACGCCGACGTGGTGGCGGAGCTCTTTGGGCGCGTCTCCTCCGACCTCCGCTCCGGATTCCGCCCCGCCCTCG[A/T]
CTCCTTCCTCGGCTTCTTCCACGCCGTCGACTGGAAGGTCGGTTTCTTTCTTATAGCCTTCTTGCCCCCCATCTGCCCTGGATCTACCTGGGATCTAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 23.30% 0.32% 0.00% NA
All Indica  2759 60.40% 39.00% 0.54% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 42.90% 55.50% 1.68% 0.00% NA
Indica II  465 78.50% 21.30% 0.22% 0.00% NA
Indica III  913 60.90% 38.90% 0.22% 0.00% NA
Indica Intermediate  786 62.50% 37.30% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800225034 T -> A LOC_Os08g01350.1 missense_variant ; p.Asp52Val; MODERATE nonsynonymous_codon ; D52V Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.109 DELETERIOUS 0.04
vg0800225034 T -> A LOC_Os08g01350.2 missense_variant ; p.Asp52Val; MODERATE nonsynonymous_codon ; D52V Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.109 DELETERIOUS 0.05

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800225034 T A -0.02 -0.02 -0.03 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800225034 1.00E-10 NA mr1277 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 2.81E-11 1.01E-10 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 NA 5.13E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 1.11E-15 NA mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 2.57E-16 1.10E-21 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 NA 2.02E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 1.80E-09 NA mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 3.82E-10 1.20E-08 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 1.32E-19 NA mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800225034 1.20E-21 2.05E-29 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251