Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800148454:

Variant ID: vg0800148454 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 148454
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCGAGAAGGTGGACAGCTCCGCCCCCGCCGCCGTCGCGTGCAGGAGGTTTGGCCGGAACATGAGGTACACCACCATCGCCACCACAAGCACGCACCCC[A/G]
TCCCCGCCACCACGCAGCTCGCCACGCCGCACACCGCCGACCGCCGGCAGGGGTAGCAAACCTCGCCGCCCGCTCCCATTCTACCTCGATCGCATCGACC

Reverse complement sequence

GGTCGATGCGATCGAGGTAGAATGGGAGCGGGCGGCGAGGTTTGCTACCCCTGCCGGCGGTCGGCGGTGTGCGGCGTGGCGAGCTGCGTGGTGGCGGGGA[T/C]
GGGGTGCGTGCTTGTGGTGGCGATGGTGGTGTACCTCATGTTCCGGCCAAACCTCCTGCACGCGACGGCGGCGGGGGCGGAGCTGTCCACCTTCTCGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.80% 0.13% 0.00% NA
All Indica  2759 62.80% 37.10% 0.14% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 47.20% 52.40% 0.37% 0.00% NA
Indica I  595 74.60% 25.20% 0.17% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 44.10% 55.60% 0.22% 0.00% NA
Indica Intermediate  786 62.30% 37.50% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 78.10% 1.04% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800148454 A -> G LOC_Os08g01210.1 start_lost ; p.Met1?; HIGH nonsynonymous_codon ; M1T Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 unknown unknown TOLERATED 0.12

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800148454 A G 0.01 0.01 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800148454 NA 5.60E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 1.16E-09 8.80E-17 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 1.38E-10 5.46E-13 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 NA 4.28E-06 mr1352 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 NA 8.81E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 7.73E-14 3.95E-23 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 1.84E-13 1.76E-16 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 2.96E-06 2.96E-06 mr1811 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 1.44E-06 7.98E-17 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 2.10E-06 6.16E-09 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 NA 7.13E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 2.39E-12 7.87E-27 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800148454 1.39E-12 5.22E-19 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251