Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800145551:

Variant ID: vg0800145551 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 145551
Reference Allele: C	Alternative Allele: A,G
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTATTGTTTGCGTATAGTTACGGTTGCGGATTTTCGTCGATCGTGGTTATCTCGAAGATTCGTGAAGCTCCGTGAAGGCCTTGAGCAAGGCAAGTCACC[C/A,G]
TTTGATCAATTGCCCCTATAATTGAAAAGTCATTATTATTTTGTTTGCAACTTGCATGATTAGAATCACACACTTAACTTGCTTGGCCTCGGTTTGCGTG

Reverse complement sequence

CACGCAAACCGAGGCCAAGCAAGTTAAGTGTGTGATTCTAATCATGCAAGTTGCAAACAAAATAATAATGACTTTTCAATTATAGGGGCAATTGATCAAA[G/T,C]
GGTGACTTGCCTTGCTCAAGGCCTTCACGGAGCTTCACGAATCTTCGAGATAACCACGATCGACGAAAATCCGCAACCGTAACTATACGCAAACAATAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.30%	3.70%	9.78%	3.20%	G: 0.02%
All Indica	2759	78.40%	5.80%	15.40%	0.40%	G: 0.04%
All Japonica	1512	91.20%	0.10%	0.73%	8.00%	NA
Aus	269	92.60%	3.70%	3.72%	0.00%	NA
Indica I	595	81.70%	1.80%	16.47%	0.00%	NA
Indica II	465	76.30%	8.60%	14.84%	0.22%	NA
Indica III	913	78.40%	7.00%	13.58%	0.88%	G: 0.11%
Indica Intermediate	786	77.10%	5.60%	17.05%	0.25%	NA
Temperate Japonica	767	98.60%	0.10%	0.78%	0.52%	NA
Tropical Japonica	504	79.40%	0.00%	0.79%	19.84%	NA
Japonica Intermediate	241	92.50%	0.00%	0.41%	7.05%	NA
VI/Aromatic	96	65.60%	3.10%	12.50%	18.75%	NA
Intermediate	90	91.10%	3.30%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800145551	C -> G	LOC_Os08g01200.1	upstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800145551	C -> G	LOC_Os08g01210.1	downstream_gene_variant ; 2338.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800145551	C -> G	LOC_Os08g01200-LOC_Os08g01210	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800145551	C -> A	LOC_Os08g01200.1	upstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800145551	C -> A	LOC_Os08g01210.1	downstream_gene_variant ; 2338.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800145551	C -> A	LOC_Os08g01200-LOC_Os08g01210	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800145551	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800145551	NA	9.64E-13	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551	NA	2.78E-06	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551	NA	1.21E-10	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551	NA	3.86E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551	1.17E-06	NA	mr1896	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551	NA	4.21E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800145551	6.05E-06	2.45E-08	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251