Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800100200:

Variant ID: vg0800100200 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 100200
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.06, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGGTCGGTTTTAAAATAAGTTTTGGCGGTAGTTCATTTGTAAAAATAGTTTTTTTTAAAAGATCAAGTTGTCAAAATTTGAGGGAGCTGGATGCATGA[A/T]
CGGGATCGGCACATGTAGTAGTACGTGGGAGTACTTGGCTAGCTAGATAGCACAGTACGTACGCAACGTGTTTCGAACGTAACATCCGTACCTTTTGCCG

Reverse complement sequence

CGGCAAAAGGTACGGATGTTACGTTCGAAACACGTTGCGTACGTACTGTGCTATCTAGCTAGCCAAGTACTCCCACGTACTACTACATGTGCCGATCCCG[T/A]
TCATGCATCCAGCTCCCTCAAATTTTGACAACTTGATCTTTTAAAAAAAACTATTTTTACAAATGAACTACCGCCAAAACTTATTTTAAAACCGACCCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.80% 0.04% 0.00% NA
All Indica  2759 45.90% 54.00% 0.04% 0.00% NA
All Japonica  1512 87.80% 12.20% 0.00% 0.00% NA
Aus  269 5.20% 94.40% 0.37% 0.00% NA
Indica I  595 66.70% 33.30% 0.00% 0.00% NA
Indica II  465 25.40% 74.60% 0.00% 0.00% NA
Indica III  913 45.00% 54.90% 0.11% 0.00% NA
Indica Intermediate  786 43.40% 56.60% 0.00% 0.00% NA
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 72.40% 27.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800100200 A -> T LOC_Os08g01140.1 upstream_gene_variant ; 3158.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800100200 A -> T LOC_Os08g01150.1 upstream_gene_variant ; 1927.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800100200 A -> T LOC_Os08g01140-LOC_Os08g01150 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0800100200 A T 0.07 0.07 0.03 -0.01 0.03 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800100200 1.17E-09 5.40E-16 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 2.73E-10 5.77E-09 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 9.96E-17 3.26E-23 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 3.21E-15 1.01E-20 mr1746 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 1.85E-11 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 4.55E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 1.63E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 7.48E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 1.23E-06 NA mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 1.17E-06 NA mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 2.79E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 2.32E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 3.16E-20 1.07E-32 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 4.57E-19 9.90E-28 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 1.16E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800100200 NA 1.67E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251