Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800005009:

Variant ID: vg0800005009 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5009
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCCCTCGGCAATGGCATACAAATTAGCCGAAGCGTTGTGGTCTTATCGGATGGCATGTCATGGATCAATTCAAGTTCCTCCTTATAAGCTTGTTTATG[G/A,C]
ACATGAAGCAGTTTTACCATGGGAAAATGTCATCGGCTCAAGGAGAATAGATTTACAAGATAAATTGACAGCCGGTGAATATTACAATCTTATGGTGGAT

Reverse complement sequence

ATCCACCATAAGATTGTAATATTCACCGGCTGTCAATTTATCTTGTAAATCTATTCTCCTTGAGCCGATGACATTTTCCCATGGTAAAACTGCTTCATGT[C/T,G]
CATAAACAAGCTTATAAGGAGGAACTTGAATTGATCCATGACATGCCATCCGATAAGACCACAACGCTTCGGCTAATTTGTATGCCATTGCCGAGGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	17.00%	1.80%	7.45%	NA
All Indica	2759	64.00%	26.00%	1.92%	8.12%	NA
All Japonica	1512	92.10%	0.50%	1.85%	5.49%	NA
Aus	269	61.30%	22.30%	1.12%	15.24%	NA
Indica I	595	74.60%	20.80%	0.67%	3.87%	NA
Indica II	465	84.90%	9.00%	0.86%	5.16%	NA
Indica III	913	46.00%	37.80%	3.40%	12.81%	NA
Indica Intermediate	786	64.40%	26.20%	1.78%	7.63%	NA
Temperate Japonica	767	99.10%	0.30%	0.13%	0.52%	NA
Tropical Japonica	504	80.60%	1.20%	4.76%	13.49%	NA
Japonica Intermediate	241	94.20%	0.00%	1.24%	4.56%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	16.70%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0800005009	G -> C	LOC_Os08g01008.1	downstream_gene_variant ; 73.0bp to feature; MODIFIER	N	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800005009	G -> C	LOC_Os08g01010.1	downstream_gene_variant ; 1554.0bp to feature; MODIFIER	N	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800005009	G -> C	LOC_Os08g01008-LOC_Os08g01010	intergenic_region ; MODIFIER	N	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800005009	G -> A	LOC_Os08g01008.1	downstream_gene_variant ; 73.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800005009	G -> A	LOC_Os08g01010.1	downstream_gene_variant ; 1554.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800005009	G -> A	LOC_Os08g01008-LOC_Os08g01010	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0800005009	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0800005009	NA	4.94E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	1.99E-11	7.43E-20	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	2.99E-10	1.18E-12	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	NA	3.86E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	NA	4.81E-06	mr1654	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	1.98E-14	1.45E-22	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	4.19E-13	2.70E-16	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	1.90E-06	NA	mr1811	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	2.21E-06	2.21E-06	mr1811	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	9.81E-07	4.00E-16	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	1.42E-06	2.53E-09	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	NA	2.61E-06	mr1403_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	4.36E-15	4.49E-30	mr1746_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800005009	4.18E-13	7.31E-20	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251