Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729558870:

Variant ID: vg0729558870 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29558870
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAATCAAACTTTGGGAATATAAATCATGAATAACTCTAAAGTTAGTTGTTGAGTTTGAAAATGTAAAAGTTATATGAATAGATTTGTCTTGAAAAATA[C/T]
TTTCATAAAAGTATACATATATCACTTTTTAATAAATATTTTTATAGAAACAAGAAGTCAAAGTTGTGTTTTGGAGACCGTGTCGCTGTCCAAAACGACT

Reverse complement sequence

AGTCGTTTTGGACAGCGACACGGTCTCCAAAACACAACTTTGACTTCTTGTTTCTATAAAAATATTTATTAAAAAGTGATATATGTATACTTTTATGAAA[G/A]
TATTTTTCAAGACAAATCTATTCATATAACTTTTACATTTTCAAACTCAACAACTAACTTTAGAGTTATTCATGATTTATATTCCCAAAGTTTGATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.80%	0.06%	0.21%	NA
All Indica	2759	28.40%	71.20%	0.04%	0.33%	NA
All Japonica	1512	87.10%	12.80%	0.13%	0.00%	NA
Aus	269	42.00%	58.00%	0.00%	0.00%	NA
Indica I	595	5.50%	94.10%	0.17%	0.17%	NA
Indica II	465	13.10%	86.50%	0.00%	0.43%	NA
Indica III	913	47.30%	52.20%	0.00%	0.44%	NA
Indica Intermediate	786	32.80%	66.90%	0.00%	0.25%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	78.20%	21.60%	0.20%	0.00%	NA
Japonica Intermediate	241	67.60%	32.00%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729558870	C -> DEL	N	N	silent_mutation	Average:30.734; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0729558870	C -> T	LOC_Os07g49350.1	upstream_gene_variant ; 831.0bp to feature; MODIFIER	silent_mutation	Average:30.734; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0729558870	C -> T	LOC_Os07g49340.1	downstream_gene_variant ; 3228.0bp to feature; MODIFIER	silent_mutation	Average:30.734; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0729558870	C -> T	LOC_Os07g49360.1	downstream_gene_variant ; 2310.0bp to feature; MODIFIER	silent_mutation	Average:30.734; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0729558870	C -> T	LOC_Os07g49350-LOC_Os07g49360	intergenic_region ; MODIFIER	silent_mutation	Average:30.734; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729558870	NA	5.67E-14	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	1.36E-09	mr1352	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	4.04E-09	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	2.80E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	6.69E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	2.48E-20	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	1.33E-09	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	3.75E-06	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	2.76E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729558870	NA	3.83E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251