Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729476993:

Variant ID: vg0729476993 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29476993
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.02, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:

TGAAATATAGGCAAAGAAAAACAGATCAAAAATCAAACATCAGCATGTTTTGTCATCTATACAAATTGGTTGAGTCCACAAAAGTATCCTGGAAAAAAAA[T/A]
AGCTATTGCTTATAACAGCAAGTTCGAAGTGAAAATACCAGTTTATATACACATATAAGCAATACCTATATGCATATATAAGCAATATACCAGTTTGGCG

Reverse complement sequence

CGCCAAACTGGTATATTGCTTATATATGCATATAGGTATTGCTTATATGTGTATATAAACTGGTATTTTCACTTCGAACTTGCTGTTATAAGCAATAGCT[A/T]
TTTTTTTTCCAGGATACTTTTGTGGACTCAACCAATTTGTATAGATGACAAAACATGCTGATGTTTGATTTTTGATCTGTTTTTCTTTGCCTATATTTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	6.50%	0.02%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.00%	0.00%	NA
All Japonica	1512	95.30%	4.70%	0.00%	0.00%	NA
Aus	269	68.80%	30.90%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	95.10%	4.90%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	86.90%	13.10%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729476993	T -> A	LOC_Os07g49230.1	upstream_gene_variant ; 1768.0bp to feature; MODIFIER	silent_mutation	Average:40.546; most accessible tissue: Callus, score: 87.467	N	N	N	N
vg0729476993	T -> A	LOC_Os07g49230.2	upstream_gene_variant ; 1765.0bp to feature; MODIFIER	silent_mutation	Average:40.546; most accessible tissue: Callus, score: 87.467	N	N	N	N
vg0729476993	T -> A	LOC_Os07g49230.3	upstream_gene_variant ; 1778.0bp to feature; MODIFIER	silent_mutation	Average:40.546; most accessible tissue: Callus, score: 87.467	N	N	N	N
vg0729476993	T -> A	LOC_Os07g49210.1	downstream_gene_variant ; 1494.0bp to feature; MODIFIER	silent_mutation	Average:40.546; most accessible tissue: Callus, score: 87.467	N	N	N	N
vg0729476993	T -> A	LOC_Os07g49220.1	intron_variant ; MODIFIER	silent_mutation	Average:40.546; most accessible tissue: Callus, score: 87.467	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729476993	NA	7.48E-07	mr1039	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	4.11E-06	mr1133	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	1.11E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	5.06E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	6.89E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	2.48E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	7.86E-33	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729476993	NA	1.81E-10	mr1696	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251