Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729244062:

Variant ID: vg0729244062 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 29244062
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATAGACACTAAACACTATTGAAATTGACAAATATTGGTAAGCCTAATTTAGGCCTCAAACCAACCAGCCCATAGTGTCTTTTGTATAAAAGTTTTCTA[T/C]
GTAAAAATTACTCTAAAATATTAGACAAATTAAAATTTTGAACTTGTAATAATTACAACTTAATTAATTAAGTAATAATTGTTTTCACCATGTCTTAACT

Reverse complement sequence

AGTTAAGACATGGTGAAAACAATTATTACTTAATTAATTAAGTTGTAATTATTACAAGTTCAAAATTTTAATTTGTCTAATATTTTAGAGTAATTTTTAC[A/G]
TAGAAAACTTTTATACAAAAGACACTATGGGCTGGTTGGTTTGAGGCCTAAATTAGGCTTACCAATATTTGTCAATTTCAATAGTGTTTAGTGTCTATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.20%	0.17%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	59.90%	39.60%	0.53%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	38.70%	60.40%	0.91%	0.00%	NA
Tropical Japonica	504	84.50%	15.30%	0.20%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0729244062	T -> C	LOC_Os07g48870.1	downstream_gene_variant ; 434.0bp to feature; MODIFIER	silent_mutation	Average:48.673; most accessible tissue: Minghui63 root, score: 89.635	N	N	N	N
vg0729244062	T -> C	LOC_Os07g48880.1	downstream_gene_variant ; 3322.0bp to feature; MODIFIER	silent_mutation	Average:48.673; most accessible tissue: Minghui63 root, score: 89.635	N	N	N	N
vg0729244062	T -> C	LOC_Os07g48880.3	downstream_gene_variant ; 3322.0bp to feature; MODIFIER	silent_mutation	Average:48.673; most accessible tissue: Minghui63 root, score: 89.635	N	N	N	N
vg0729244062	T -> C	LOC_Os07g48880.4	downstream_gene_variant ; 3322.0bp to feature; MODIFIER	silent_mutation	Average:48.673; most accessible tissue: Minghui63 root, score: 89.635	N	N	N	N
vg0729244062	T -> C	LOC_Os07g48880.2	downstream_gene_variant ; 4405.0bp to feature; MODIFIER	silent_mutation	Average:48.673; most accessible tissue: Minghui63 root, score: 89.635	N	N	N	N
vg0729244062	T -> C	LOC_Os07g48870-LOC_Os07g48880	intergenic_region ; MODIFIER	silent_mutation	Average:48.673; most accessible tissue: Minghui63 root, score: 89.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0729244062	NA	6.57E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729244062	NA	2.36E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729244062	6.60E-06	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729244062	1.81E-08	2.54E-40	mr1137_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729244062	NA	2.01E-14	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729244062	NA	2.00E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729244062	6.98E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251