Variant ID: vg0729244062 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 29244062 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATAGACACTAAACACTATTGAAATTGACAAATATTGGTAAGCCTAATTTAGGCCTCAAACCAACCAGCCCATAGTGTCTTTTGTATAAAAGTTTTCTA[T/C]
GTAAAAATTACTCTAAAATATTAGACAAATTAAAATTTTGAACTTGTAATAATTACAACTTAATTAATTAAGTAATAATTGTTTTCACCATGTCTTAACT
AGTTAAGACATGGTGAAAACAATTATTACTTAATTAATTAAGTTGTAATTATTACAAGTTCAAAATTTTAATTTGTCTAATATTTTAGAGTAATTTTTAC[A/G]
TAGAAAACTTTTATACAAAAGACACTATGGGCTGGTTGGTTTGAGGCCTAAATTAGGCTTACCAATATTTGTCAATTTCAATAGTGTTTAGTGTCTATTT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.60% | 13.20% | 0.17% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 59.90% | 39.60% | 0.53% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 38.70% | 60.40% | 0.91% | 0.00% | NA |
Tropical Japonica | 504 | 84.50% | 15.30% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0729244062 | T -> C | LOC_Os07g48870.1 | downstream_gene_variant ; 434.0bp to feature; MODIFIER | silent_mutation | Average:48.673; most accessible tissue: Minghui63 root, score: 89.635 | N | N | N | N |
vg0729244062 | T -> C | LOC_Os07g48880.1 | downstream_gene_variant ; 3322.0bp to feature; MODIFIER | silent_mutation | Average:48.673; most accessible tissue: Minghui63 root, score: 89.635 | N | N | N | N |
vg0729244062 | T -> C | LOC_Os07g48880.3 | downstream_gene_variant ; 3322.0bp to feature; MODIFIER | silent_mutation | Average:48.673; most accessible tissue: Minghui63 root, score: 89.635 | N | N | N | N |
vg0729244062 | T -> C | LOC_Os07g48880.4 | downstream_gene_variant ; 3322.0bp to feature; MODIFIER | silent_mutation | Average:48.673; most accessible tissue: Minghui63 root, score: 89.635 | N | N | N | N |
vg0729244062 | T -> C | LOC_Os07g48880.2 | downstream_gene_variant ; 4405.0bp to feature; MODIFIER | silent_mutation | Average:48.673; most accessible tissue: Minghui63 root, score: 89.635 | N | N | N | N |
vg0729244062 | T -> C | LOC_Os07g48870-LOC_Os07g48880 | intergenic_region ; MODIFIER | silent_mutation | Average:48.673; most accessible tissue: Minghui63 root, score: 89.635 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0729244062 | NA | 6.57E-10 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729244062 | NA | 2.36E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729244062 | 6.60E-06 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729244062 | 1.81E-08 | 2.54E-40 | mr1137_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729244062 | NA | 2.01E-14 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729244062 | NA | 2.00E-08 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0729244062 | 6.98E-06 | NA | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |