Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728870674:

Variant ID: vg0728870674 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28870674
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGACACGGGAACCCACAACTGCTCTTAGGGTGTCTTTAGTTCACACTAAAATTGAAAAATTGGCTGAAATTGGAAACAGAAAAAAGTCATAAATTTAT[G/A]
TGTATAGAAAAGTTTTGATGTGATGGAAAAGTTTAAAGTTTGAAAAAAAAAGCTTGCAACTAAACACGGTGTTAAATTGGGAGGGAGGCAGGAGTACTAG

Reverse complement sequence

CTAGTACTCCTGCCTCCCTCCCAATTTAACACCGTGTTTAGTTGCAAGCTTTTTTTTTCAAACTTTAAACTTTTCCATCACATCAAAACTTTTCTATACA[C/T]
ATAAATTTATGACTTTTTTCTGTTTCCAATTTCAGCCAATTTTTCAATTTTAGTGTGAACTAAAGACACCCTAAGAGCAGTTGTGGGTTCCCGTGTCCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	44.20%	0.28%	0.00%	NA
All Indica	2759	90.10%	9.60%	0.36%	0.00%	NA
All Japonica	1512	2.60%	97.30%	0.07%	0.00%	NA
Aus	269	17.50%	82.50%	0.00%	0.00%	NA
Indica I	595	92.10%	7.40%	0.50%	0.00%	NA
Indica II	465	91.20%	8.00%	0.86%	0.00%	NA
Indica III	913	93.60%	6.40%	0.00%	0.00%	NA
Indica Intermediate	786	83.70%	15.90%	0.38%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	5.40%	94.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	30.00%	67.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728870674	G -> A	LOC_Os07g48310.1	upstream_gene_variant ; 2045.0bp to feature; MODIFIER	silent_mutation	Average:57.707; most accessible tissue: Minghui63 flower, score: 83.835	N	N	N	N
vg0728870674	G -> A	LOC_Os07g48310.2	upstream_gene_variant ; 3373.0bp to feature; MODIFIER	silent_mutation	Average:57.707; most accessible tissue: Minghui63 flower, score: 83.835	N	N	N	N
vg0728870674	G -> A	LOC_Os07g48310-LOC_Os07g48320	intergenic_region ; MODIFIER	silent_mutation	Average:57.707; most accessible tissue: Minghui63 flower, score: 83.835	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728870674	NA	2.76E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	1.41E-15	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	9.91E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	5.96E-07	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	3.23E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	7.44E-08	mr1771	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	4.92E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	1.27E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728870674	NA	3.20E-07	mr1837	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251