Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728442720:

Variant ID: vg0728442720 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28442720
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

AAGATGGTTGCCACGCACGGATAGAGTCCTGGGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAGGTTCCATATAGATAAATGTGGGCAAAAGT[C/A]
TGCCGCAAAGACTTGTGGTATCTTAGAGTTTGTTAGAGATAATAGTAGTATGGGCATATCTTGTAATTCTCGGGTATAAATAGACCCCGAGCCATATGTA

Reverse complement sequence

TACATATGGCTCGGGGTCTATTTATACCCGAGAATTACAAGATATGCCCATACTACTATTATCTCTAACAAACTCTAAGATACCACAAGTCTTTGCGGCA[G/T]
ACTTTTGCCCACATTTATCTATATGGAACCTACATAAAATATCCTAATTAATAGATACAATTGCCTTCCCAGGACTCTATCCGTGCGTGGCAACCATCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	5.20%	0.47%	0.00%	NA
All Indica	2759	91.30%	7.90%	0.76%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	89.20%	9.40%	1.34%	0.00%	NA
Indica II	465	97.00%	1.90%	1.08%	0.00%	NA
Indica III	913	88.30%	11.40%	0.33%	0.00%	NA
Indica Intermediate	786	93.00%	6.40%	0.64%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	1.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728442720	C -> A	LOC_Os07g47550.1	upstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:62.647; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0728442720	C -> A	LOC_Os07g47570.1	upstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:62.647; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0728442720	C -> A	LOC_Os07g47560.1	downstream_gene_variant ; 1147.0bp to feature; MODIFIER	silent_mutation	Average:62.647; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0728442720	C -> A	LOC_Os07g47550-LOC_Os07g47560	intergenic_region ; MODIFIER	silent_mutation	Average:62.647; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728442720	2.79E-18	1.30E-27	mr1038	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	1.80E-16	1.52E-26	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	3.24E-20	5.01E-34	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	3.34E-18	2.80E-31	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	8.61E-22	1.05E-36	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	2.35E-20	5.02E-34	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	2.48E-08	NA	mr1141_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	4.64E-08	2.06E-11	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	NA	9.05E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	2.30E-17	4.43E-30	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728442720	7.51E-16	1.94E-28	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251