Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728385374:

Variant ID: vg0728385374 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28385374
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATTAATACGTGATTAAAAATAGATTAATATGGTTTATAAAACAATTTTTTTATATATGTATTTTCAAAAAAAAAGTCTGTTTAATAATTTAAGAAGCG[T/A]
GGACGTAAAAAAAAAGAGAAAGAAGAGACGGCAACATTAACAACCCAACACAGCTGTTGGTCAAAGTTGTGTTGTGACCAAAAGGAGCACAGAGACTGTT

Reverse complement sequence

AACAGTCTCTGTGCTCCTTTTGGTCACAACACAACTTTGACCAACAGCTGTGTTGGGTTGTTAATGTTGCCGTCTCTTCTTTCTCTTTTTTTTTACGTCC[A/T]
CGCTTCTTAAATTATTAAACAGACTTTTTTTTTGAAAATACATATATAAAAAAATTGTTTTATAAACCATATTAATCTATTTTTAATCACGTATTAATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.50%	6.20%	0.25%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	93.60%	6.10%	0.33%	0.00%	NA
Aus	269	27.90%	69.90%	2.23%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	81.50%	17.70%	0.79%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728385374	T -> A	LOC_Os07g47480.2	downstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:76.658; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N
vg0728385374	T -> A	LOC_Os07g47480.1	downstream_gene_variant ; 1229.0bp to feature; MODIFIER	silent_mutation	Average:76.658; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N
vg0728385374	T -> A	LOC_Os07g47480-LOC_Os07g47490	intergenic_region ; MODIFIER	silent_mutation	Average:76.658; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728385374	NA	2.12E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	5.99E-08	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	3.38E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	8.16E-07	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	3.58E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	4.16E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	1.35E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	1.26E-40	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	2.86E-10	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	1.29E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	7.14E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	2.11E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	2.23E-08	NA	mr1301_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	3.41E-08	NA	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	2.81E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728385374	NA	1.12E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251