Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728265516:

Variant ID: vg0728265516 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28265516
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTGTGCAAATCAATTTAACAACTATGTATTGATGTCCTCATACTCTCTGTTATTTTAGGTCATTCCAACTATGGCGAGAAAGTGTCTGTTGATCAGGA[A/G]
GGAGCAAACAATTCTACTCTTTCACCATATATGGGAGGTCCTGCTTTGATGGATGATTCTCCTGCATCTAAAATGGCTTTGGAGCATAGCATTACGACAT

Reverse complement sequence

ATGTCGTAATGCTATGCTCCAAAGCCATTTTAGATGCAGGAGAATCATCCATCAAAGCAGGACCTCCCATATATGGTGAAAGAGTAGAATTGTTTGCTCC[T/C]
TCCTGATCAACAGACACTTTCTCGCCATAGTTGGAATGACCTAAAATAACAGAGAGTATGAGGACATCAATACATAGTTGTTAAATTGATTTGCACAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.10% 0.63% 0.00% NA
All Indica  2759 67.30% 31.90% 0.72% 0.00% NA
All Japonica  1512 29.00% 70.60% 0.46% 0.00% NA
Aus  269 5.60% 94.10% 0.37% 0.00% NA
Indica I  595 41.80% 55.80% 2.35% 0.00% NA
Indica II  465 88.60% 10.80% 0.65% 0.00% NA
Indica III  913 72.10% 27.80% 0.11% 0.00% NA
Indica Intermediate  786 68.60% 31.20% 0.25% 0.00% NA
Temperate Japonica  767 1.40% 97.90% 0.65% 0.00% NA
Tropical Japonica  504 73.80% 26.00% 0.20% 0.00% NA
Japonica Intermediate  241 22.80% 76.80% 0.41% 0.00% NA
VI/Aromatic  96 69.80% 29.20% 1.04% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728265516 A -> G LOC_Os07g47284.1 intron_variant ; MODIFIER silent_mutation Average:48.06; most accessible tissue: Callus, score: 69.457 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728265516 NA 2.83E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.20E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.07E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.69E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 3.33E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 2.39E-06 NA mr1099_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 2.05E-07 6.71E-14 mr1304_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 3.42E-10 mr1308_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.04E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.38E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 9.33E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 6.83E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.36E-11 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 6.63E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 3.41E-06 2.45E-15 mr1368_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 6.02E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.14E-10 mr1401_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.29E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.68E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 8.45E-10 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 6.97E-11 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 9.59E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 5.28E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 4.21E-07 7.89E-15 mr1584_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.77E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.60E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.86E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 3.44E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 4.16E-06 1.07E-08 mr1730_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 5.32E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 5.26E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 6.93E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 9.86E-08 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.58E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 2.39E-06 7.59E-10 mr1866_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 5.63E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.69E-09 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.91E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.35E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 2.81E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 8.14E-13 mr1942_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 4.41E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728265516 NA 1.26E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251