Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727791830:

Variant ID: vg0727791830 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27791830
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGATTTAAAATTAGTGGACGTGAAACAAATACTACTACTATGAAGTAAGATTGTTGTAAGGTAGTGAGTGTAAACACCTTCTGCGAGACACACGTCT[C/T]
ATTGGAGCACTGTCTTCTGAGTCTTCCGGTTCTCTCATTTTATTTATCCTTGAACGCGACACGCCTGCATAATGCATGGAACAGATTCCTTGAGAAACTG

Reverse complement sequence

CAGTTTCTCAAGGAATCTGTTCCATGCATTATGCAGGCGTGTCGCGTTCAAGGATAAATAAAATGAGAGAACCGGAAGACTCAGAAGACAGTGCTCCAAT[G/A]
AGACGTGTGTCTCGCAGAAGGTGTTTACACTCACTACCTTACAACAATCTTACTTCATAGTAGTAGTATTTGTTTCACGTCCACTAATTTTAAATCTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.80% 0.00% 0.00% NA
All Indica  2759 95.40% 4.60% 0.00% 0.00% NA
All Japonica  1512 41.80% 58.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 22.20% 77.80% 0.00% 0.00% NA
Tropical Japonica  504 78.80% 21.20% 0.00% 0.00% NA
Japonica Intermediate  241 27.00% 73.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727791830 C -> T LOC_Os07g46540.1 missense_variant ; p.Met1315Ile; MODERATE nonsynonymous_codon ; M1315I Average:78.181; most accessible tissue: Minghui63 flag leaf, score: 97.957 possibly damaging -1.594 TOLERATED 0.27

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727791830 C T -0.04 0.01 0.03 -0.05 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727791830 NA 2.36E-07 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 2.46E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 4.79E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 7.18E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 4.12E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 7.35E-06 mr1156_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 9.59E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 2.73E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727791830 NA 5.63E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251