Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727691010:

Variant ID: vg0727691010 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27691010
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTAAATTTTTTTTGCTCTTCGATTAAATCTTCATTGCCCAATCATTTTTCAAAGAAATCCAGTGATGGGATGCAATCTTCGAACTTACATTTTTTAG[C/G]
ACAGCAGATCAATATTGACAAGGCAGGAAGAAAGTGACTCAAATTTTGAGCTATCATTGTGTTGTTATATTTTGATAGTATCTGTCCAGCCAGATGGTTT

Reverse complement sequence

AAACCATCTGGCTGGACAGATACTATCAAAATATAACAACACAATGATAGCTCAAAATTTGAGTCACTTTCTTCCTGCCTTGTCAATATTGATCTGCTGT[G/C]
CTAAAAAATGTAAGTTCGAAGATTGCATCCCATCACTGGATTTCTTTGAAAAATGATTGGGCAATGAAGATTTAATCGAAGAGCAAAAAAAATTTAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.40%	0.10%	1.16%	16.31%	NA
All Indica	2759	93.80%	0.00%	0.36%	5.84%	NA
All Japonica	1512	59.70%	0.30%	2.71%	37.30%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	82.00%	0.00%	0.67%	17.31%	NA
Indica II	465	98.90%	0.00%	0.22%	0.86%	NA
Indica III	913	98.50%	0.00%	0.22%	1.31%	NA
Indica Intermediate	786	94.30%	0.00%	0.38%	5.34%	NA
Temperate Japonica	767	78.40%	0.40%	4.04%	17.21%	NA
Tropical Japonica	504	40.50%	0.20%	0.99%	58.33%	NA
Japonica Intermediate	241	40.20%	0.40%	2.07%	57.26%	NA
VI/Aromatic	96	65.60%	1.00%	1.04%	32.29%	NA
Intermediate	90	82.20%	0.00%	3.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727691010	C -> DEL	N	N	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0727691010	C -> G	LOC_Os07g46400.1	upstream_gene_variant ; 2118.0bp to feature; MODIFIER	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0727691010	C -> G	LOC_Os07g46410.1	upstream_gene_variant ; 3612.0bp to feature; MODIFIER	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0727691010	C -> G	LOC_Os07g46390.1	downstream_gene_variant ; 4483.0bp to feature; MODIFIER	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0727691010	C -> G	LOC_Os07g46390.3	downstream_gene_variant ; 4483.0bp to feature; MODIFIER	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0727691010	C -> G	LOC_Os07g46390.2	downstream_gene_variant ; 4483.0bp to feature; MODIFIER	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0727691010	C -> G	LOC_Os07g46400-LOC_Os07g46410	intergenic_region ; MODIFIER	silent_mutation	Average:21.77; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727691010	4.13E-06	6.67E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010	1.23E-06	2.11E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010	2.73E-06	7.16E-07	mr1515	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010	9.07E-06	1.80E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010	3.30E-07	1.12E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727691010	NA	7.96E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251