Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0727548424:

Variant ID: vg0727548424 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27548424
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.25, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCACCATATTTTTGTGTACTAATGCAATATAGCATTGGCAAGTGACAACTGCTTTCCGTTCTGATTGTTGCTGCTATTGTATGCGTTTTCAACCATA[A/T]
TTTTGTGCACTGTGTTGGCAAGTGACAACTGCATATACTGTTGTAGTGGAGTTCATGTTACTTGATTTGTGCTTACTAGCTTTAAAATATTTCATACTCC

Reverse complement sequence

GGAGTATGAAATATTTTAAAGCTAGTAAGCACAAATCAAGTAACATGAACTCCACTACAACAGTATATGCAGTTGTCACTTGCCAACACAGTGCACAAAA[T/A]
TATGGTTGAAAACGCATACAATAGCAGCAACAATCAGAACGGAAAGCAGTTGTCACTTGCCAATGCTATATTGCATTAGTACACAAAAATATGGTGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	42.00%	0.00%	0.23%	NA
All Indica	2759	67.10%	32.50%	0.00%	0.36%	NA
All Japonica	1512	43.10%	56.90%	0.00%	0.00%	NA
Aus	269	61.70%	38.30%	0.00%	0.00%	NA
Indica I	595	93.40%	6.60%	0.00%	0.00%	NA
Indica II	465	93.50%	6.20%	0.00%	0.22%	NA
Indica III	913	42.80%	56.60%	0.00%	0.55%	NA
Indica Intermediate	786	59.70%	39.80%	0.00%	0.51%	NA
Temperate Japonica	767	66.80%	33.20%	0.00%	0.00%	NA
Tropical Japonica	504	12.90%	87.10%	0.00%	0.00%	NA
Japonica Intermediate	241	31.10%	68.90%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	53.30%	45.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727548424	A -> DEL	N	N	silent_mutation	Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0727548424	A -> T	LOC_Os07g46150.1	upstream_gene_variant ; 4542.0bp to feature; MODIFIER	silent_mutation	Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0727548424	A -> T	LOC_Os07g46170.1	upstream_gene_variant ; 2408.0bp to feature; MODIFIER	silent_mutation	Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N
vg0727548424	A -> T	LOC_Os07g46160.1	intron_variant ; MODIFIER	silent_mutation	Average:61.494; most accessible tissue: Minghui63 young leaf, score: 71.839	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727548424	NA	2.01E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727548424	9.68E-06	1.34E-09	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	1.70E-12	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	3.77E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	1.30E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	2.39E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	8.28E-14	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	2.99E-06	mr1186_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	7.73E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	8.40E-07	NA	mr1368_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	4.73E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727548424	NA	1.13E-06	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251