Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727185062:

Variant ID: vg0727185062 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27185062
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


TTATAATCTAATAACAATAAAAAAAGTAGTTATAAAAAAATTTTAAATAAGACGGACGATCAAAGTTAGACATGTAATCTCATGGCTGCATTTATTTGGG[A/G]
ACGGAGGTAGTTTTCACAAACGGAAAATAATTTATAAATATATGTTCTTAGTAATCTAAAGTAAAGACTAAAAAACAAACTACCCCAAAATTAGGTTCAA

Reverse complement sequence

TTGAACCTAATTTTGGGGTAGTTTGTTTTTTAGTCTTTACTTTAGATTACTAAGAACATATATTTATAAATTATTTTCCGTTTGTGAAAACTACCTCCGT[T/C]
CCCAAATAAATGCAGCCATGAGATTACATGTCTAACTTTGATCGTCCGTCTTATTTAAAATTTTTTTATAACTACTTTTTTTATTGTTATTAGATTATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 30.40% 7.24% 24.48% NA
All Indica  2759 10.10% 41.90% 9.39% 38.64% NA
All Japonica  1512 96.80% 1.50% 1.06% 0.60% NA
Aus  269 1.50% 56.10% 18.96% 23.42% NA
Indica I  595 9.60% 53.90% 7.56% 28.91% NA
Indica II  465 6.70% 17.20% 14.84% 61.29% NA
Indica III  913 2.70% 55.00% 7.34% 34.94% NA
Indica Intermediate  786 21.10% 32.10% 9.92% 36.90% NA
Temperate Japonica  767 99.10% 0.00% 0.13% 0.78% NA
Tropical Japonica  504 94.00% 3.00% 2.78% 0.20% NA
Japonica Intermediate  241 95.40% 3.30% 0.41% 0.83% NA
VI/Aromatic  96 0.00% 83.30% 9.38% 7.29% NA
Intermediate  90 48.90% 30.00% 7.78% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727185062 A -> DEL N N silent_mutation Average:85.943; most accessible tissue: Callus, score: 95.152 N N N N
vg0727185062 A -> G LOC_Os07g45560.1 intron_variant ; MODIFIER silent_mutation Average:85.943; most accessible tissue: Callus, score: 95.152 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727185062 A G 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727185062 NA 3.16E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 3.25E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 2.78E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 2.66E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 4.53E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 4.15E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 5.69E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 1.71E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 1.75E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 2.53E-06 3.84E-10 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 6.89E-06 1.93E-10 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 1.79E-17 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 5.38E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 7.57E-06 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 6.47E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 2.52E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 6.30E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 6.34E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 1.05E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 7.03E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 1.18E-23 mr1682_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 8.90E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 3.01E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 5.80E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 6.56E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 1.22E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727185062 NA 2.49E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251