Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726740555:

Variant ID: vg0726740555 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26740555
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTTGTGGGCGAGTCTAAGTTGTGCCAAGATCTCAATTCAAATCCGTCCTTGATCCCTCTCGTCACCATCAAAAATTGCCTCCTCGAAATTCCTCTTCC[A/G]
ACTCAAGTCTCCAAATCAAACTCTGAAATTCTATCCCTCTCTTTGAATCATCGCCAAATACTTCCCCAGATCCAAAATATCCAAAACCCCATCTTGAATC

Reverse complement sequence

GATTCAAGATGGGGTTTTGGATATTTTGGATCTGGGGAAGTATTTGGCGATGATTCAAAGAGAGGGATAGAATTTCAGAGTTTGATTTGGAGACTTGAGT[T/C]
GGAAGAGGAATTTCGAGGAGGCAATTTTTGATGGTGACGAGAGGGATCAAGGACGGATTTGAATTGAGATCTTGGCACAACTTAGACTCGCCCACAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.50%	12.20%	5.40%	9.97%	NA
All Indica	2759	98.20%	1.20%	0.47%	0.22%	NA
All Japonica	1512	19.30%	34.70%	15.34%	30.62%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	97.30%	1.80%	0.67%	0.17%	NA
Indica II	465	98.30%	1.10%	0.22%	0.43%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	2.00%	1.02%	0.38%	NA
Temperate Japonica	767	5.50%	56.10%	6.13%	32.33%	NA
Tropical Japonica	504	36.50%	5.80%	23.81%	33.93%	NA
Japonica Intermediate	241	27.40%	27.40%	26.97%	18.26%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	18.90%	10.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726740555	A -> DEL	N	N	silent_mutation	Average:22.451; most accessible tissue: Callus, score: 51.48	N	N	N	N
vg0726740555	A -> G	LOC_Os07g44800.1	downstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:22.451; most accessible tissue: Callus, score: 51.48	N	N	N	N
vg0726740555	A -> G	LOC_Os07g44810.1	downstream_gene_variant ; 515.0bp to feature; MODIFIER	silent_mutation	Average:22.451; most accessible tissue: Callus, score: 51.48	N	N	N	N
vg0726740555	A -> G	LOC_Os07g44800-LOC_Os07g44810	intergenic_region ; MODIFIER	silent_mutation	Average:22.451; most accessible tissue: Callus, score: 51.48	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726740555	NA	2.14E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726740555	2.88E-06	2.88E-06	mr1853	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726740555	NA	1.84E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726740555	NA	1.51E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726740555	NA	4.34E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726740555	NA	5.34E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251