Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726399988:

Variant ID: vg0726399988 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 26399988
Reference Allele: A	Alternative Allele: T,AT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, AT: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGAGATATTACACAATTCTGCTATATGCATGCCTGCAATGTGCACAGGACACCCTTGTACTTTTTTTGATAAAGGTAGCTATTTACTGAAAAAAAAA[A/T,AT]
GACCTATTTGGTTAGGGTCATGTCACAGTAGAGTGCCTAGCTGGCGCATAATTATGTCTGATAAAAAAAAGGGTTTCATATATGTCTTTTGGTAACACTT

Reverse complement sequence

AAGTGTTACCAAAAGACATATATGAAACCCTTTTTTTTATCAGACATAATTATGCGCCAGCTAGGCACTCTACTGTGACATGACCCTAACCAAATAGGTC[T/A,AT]
TTTTTTTTTCAGTAAATAGCTACCTTTATCAAAAAAAGTACAAGGGTGTCCTGTGCACATTGCAGGCATGCATATAGCAGAATTGTGTAATATCTCAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	23.20%	0.08%	0.00%	AT: 0.06%
All Indica	2759	90.50%	9.40%	0.07%	0.00%	AT: 0.04%
All Japonica	1512	46.00%	53.90%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	91.20%	8.80%	0.00%	0.00%	NA
Indica III	913	82.70%	17.10%	0.22%	0.00%	NA
Indica Intermediate	786	93.40%	6.50%	0.00%	0.00%	AT: 0.13%
Temperate Japonica	767	8.60%	91.30%	0.13%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	59.80%	40.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	24.40%	1.11%	0.00%	AT: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726399988	A -> AT	LOC_Os07g44180.1	upstream_gene_variant ; 3685.0bp to feature; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> AT	LOC_Os07g44160.1	downstream_gene_variant ; 3132.0bp to feature; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> AT	LOC_Os07g44170.1	downstream_gene_variant ; 377.0bp to feature; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> AT	LOC_Os07g44170-LOC_Os07g44180	intergenic_region ; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> T	LOC_Os07g44180.1	upstream_gene_variant ; 3686.0bp to feature; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> T	LOC_Os07g44160.1	downstream_gene_variant ; 3131.0bp to feature; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> T	LOC_Os07g44170.1	downstream_gene_variant ; 376.0bp to feature; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N
vg0726399988	A -> T	LOC_Os07g44170-LOC_Os07g44180	intergenic_region ; MODIFIER	silent_mutation	Average:65.549; most accessible tissue: Callus, score: 89.016	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0726399988	A	AT	-0.22	-0.06	-0.03	-0.06	-0.08	0.1
vg0726399988	A	T	-0.01	-0.03	-0.03	-0.03	-0.06	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726399988	NA	1.01E-09	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	2.09E-16	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	7.35E-11	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	1.68E-16	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	8.40E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	4.41E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	2.34E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	1.97E-20	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	2.72E-07	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	7.17E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	6.16E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	3.03E-08	1.28E-19	mr1853	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	9.68E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	8.10E-18	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	1.06E-21	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	8.55E-08	2.79E-11	mr1676_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	4.70E-15	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726399988	NA	5.00E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251