Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726065533:

Variant ID: vg0726065533 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26065533
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.25, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTGGATGAGACATCCTAGTGATAGGAATCTAAATAGAGAGCCTCTTCAGAATTTTAGTACTAGAATATATTTCATCCAACTAAAATCTTTTATATTTT[C/T]
GGATGGATGGAGTAGAATCAATCTTGTTATGGGACAAGAAGACAAGAAGCTGGATAATAGCAAGGACTTTCTTGTATTGAGGTACATTAATCGCAGTTCC

Reverse complement sequence

GGAACTGCGATTAATGTACCTCAATACAAGAAAGTCCTTGCTATTATCCAGCTTCTTGTCTTCTTGTCCCATAACAAGATTGATTCTACTCCATCCATCC[G/A]
AAAATATAAAAGATTTTAGTTGGATGAAATATATTCTAGTACTAAAATTCTGAAGAGGCTCTCTATTTAGATTCCTATCACTAGGATGTCTCATCCAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	33.80%	0.72%	26.36%	NA
All Indica	2759	5.80%	54.50%	1.12%	38.53%	NA
All Japonica	1512	96.20%	0.20%	0.07%	3.57%	NA
Aus	269	30.10%	25.70%	0.37%	43.87%	NA
Indica I	595	8.90%	31.30%	1.18%	58.66%	NA
Indica II	465	9.20%	70.50%	1.08%	19.14%	NA
Indica III	913	1.30%	64.50%	0.88%	33.30%	NA
Indica Intermediate	786	6.60%	51.10%	1.40%	40.84%	NA
Temperate Japonica	767	97.10%	0.10%	0.00%	2.74%	NA
Tropical Japonica	504	95.00%	0.20%	0.20%	4.56%	NA
Japonica Intermediate	241	95.40%	0.40%	0.00%	4.15%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	67.80%	20.00%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726065533	C -> DEL	N	N	silent_mutation	Average:42.385; most accessible tissue: Callus, score: 89.061	N	N	N	N
vg0726065533	C -> T	LOC_Os07g43570.1	upstream_gene_variant ; 2329.0bp to feature; MODIFIER	silent_mutation	Average:42.385; most accessible tissue: Callus, score: 89.061	N	N	N	N
vg0726065533	C -> T	LOC_Os07g43570-LOC_Os07g43580	intergenic_region ; MODIFIER	silent_mutation	Average:42.385; most accessible tissue: Callus, score: 89.061	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726065533	5.03E-08	1.91E-13	mr1004_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726065533	NA	7.22E-07	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726065533	NA	9.57E-06	mr1010_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726065533	NA	6.71E-06	mr1013_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251