Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725923094:

Variant ID: vg0725923094 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25923094
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GTTACCAAAATTTAGTAGCAAACTAAATATAGCCACTTTTTTGGTAACTTTATCAAAATTTGGTAAGGTTGAAAATATCATCAAAATGAATAGGCCCTTA[T/G,A]
TAATAACACCCATTTGAGTTTGACTCGTTTTGAATTAATTTTGGGATAATTAGCCGTGATATTTGGTTTACGAGAATTGTTTAGGTGCATTCAGGTGTAG

Reverse complement sequence

CTACACCTGAATGCACCTAAACAATTCTCGTAAACCAAATATCACGGCTAATTATCCCAAAATTAATTCAAAACGAGTCAAACTCAAATGGGTGTTATTA[A/C,T]
TAAGGGCCTATTCATTTTGATGATATTTTCAACCTTACCAAATTTTGATAAAGTTACCAAAAAAGTGGCTATATTTAGTTTGCTACTAAATTTTGGTAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	41.50%	0.19%	0.00%	A: 0.04%
All Indica	2759	90.00%	9.70%	0.29%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	86.20%	13.40%	0.37%	0.00%	NA
Indica I	595	92.30%	7.20%	0.50%	0.00%	NA
Indica II	465	91.40%	8.60%	0.00%	0.00%	NA
Indica III	913	90.70%	9.30%	0.00%	0.00%	NA
Indica Intermediate	786	86.50%	12.80%	0.64%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	27.80%	70.00%	0.00%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725923094	T -> G	LOC_Os07g43290.1	upstream_gene_variant ; 223.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> G	LOC_Os07g43300.1	upstream_gene_variant ; 3996.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> G	LOC_Os07g43290.2	upstream_gene_variant ; 288.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> G	LOC_Os07g43270.1	downstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> G	LOC_Os07g43290-LOC_Os07g43300	intergenic_region ; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> A	LOC_Os07g43290.1	upstream_gene_variant ; 223.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> A	LOC_Os07g43300.1	upstream_gene_variant ; 3996.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> A	LOC_Os07g43290.2	upstream_gene_variant ; 288.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> A	LOC_Os07g43270.1	downstream_gene_variant ; 3706.0bp to feature; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N
vg0725923094	T -> A	LOC_Os07g43290-LOC_Os07g43300	intergenic_region ; MODIFIER	silent_mutation	Average:75.794; most accessible tissue: Zhenshan97 flower, score: 93.944	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0725923094	T	A	-0.06	-0.03	-0.02	-0.01	-0.03	-0.04
vg0725923094	T	G	-0.01	-0.04	-0.03	-0.03	-0.04	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725923094	NA	1.48E-25	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725923094	NA	7.71E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725923094	NA	3.80E-28	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725923094	NA	1.23E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725923094	NA	6.82E-24	mr1304_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725923094	NA	2.15E-32	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725923094	NA	9.36E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251