Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725219323:

Variant ID: vg0725219323 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25219323
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGAAACCAAAATCAACCCCCCAAGGGCATAGGGGACCATATATATGACTACTTATGATAACTATAGTAACCATGTAATACAATATTTAATTCAAACA[T/C]
AGACCCAATACCAAGACATGCATGTTTTGCATTAAAATCTTTACAACAATGTTTCAGGCTATGATGAGAATATTAAATTCTAAAATTAGGCACATGGTAT

Reverse complement sequence

ATACCATGTGCCTAATTTTAGAATTTAATATTCTCATCATAGCCTGAAACATTGTTGTAAAGATTTTAATGCAAAACATGCATGTCTTGGTATTGGGTCT[A/G]
TGTTTGAATTAAATATTGTATTACATGGTTACTATAGTTATCATAAGTAGTCATATATATGGTCCCCTATGCCCTTGGGGGGTTGATTTTGGTTTCCATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	25.20%	0.11%	0.00%	NA
All Indica	2759	97.40%	2.50%	0.11%	0.00%	NA
All Japonica	1512	33.90%	66.10%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	98.70%	1.00%	0.34%	0.00%	NA
Indica II	465	91.80%	8.00%	0.22%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.80%	0.00%	0.00%	NA
Temperate Japonica	767	61.80%	38.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	14.50%	85.50%	0.00%	0.00%	NA
VI/Aromatic	96	13.50%	86.50%	0.00%	0.00%	NA
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725219323	T -> C	LOC_Os07g42140.1	upstream_gene_variant ; 2703.0bp to feature; MODIFIER	silent_mutation	Average:25.826; most accessible tissue: Callus, score: 71.733	N	N	N	N
vg0725219323	T -> C	LOC_Os07g42150.1	downstream_gene_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:25.826; most accessible tissue: Callus, score: 71.733	N	N	N	N
vg0725219323	T -> C	LOC_Os07g42140-LOC_Os07g42150	intergenic_region ; MODIFIER	silent_mutation	Average:25.826; most accessible tissue: Callus, score: 71.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725219323	NA	4.01E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	2.06E-06	NA	mr1415	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	2.06E-06	NA	mr1567	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	7.63E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	1.89E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	7.22E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	7.27E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	4.97E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	1.64E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	9.45E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	6.99E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	3.92E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	1.16E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725219323	NA	6.87E-07	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251