Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724905355:

Variant ID: vg0724905355 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24905355
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TACTATCAGTATCAGTAATCAGCCATGCCATGCCATGTTTTGTCGAGCTCACAAGATTGGAATCTCCCGCTAGGGAATCAATTTTCAACTGTAATTTGCC[C/T]
CGCTTTCTGCGGTGAGATTTGCAGGTGCGCAATATGTAATTCACCATTTTCATCGCTCATCGCTCTCTTGCTCATTTCACCCGGTTGTCCGATGCAAAGT

Reverse complement sequence

ACTTTGCATCGGACAACCGGGTGAAATGAGCAAGAGAGCGATGAGCGATGAAAATGGTGAATTACATATTGCGCACCTGCAAATCTCACCGCAGAAAGCG[G/A]
GGCAAATTACAGTTGAAAATTGATTCCCTAGCGGGAGATTCCAATCTTGTGAGCTCGACAAAACATGGCATGGCATGGCTGATTACTGATACTGATAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 5.30% 0.59% 0.06% NA
All Indica  2759 94.60% 4.30% 0.98% 0.11% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 53.90% 46.10% 0.00% 0.00% NA
Indica I  595 84.20% 14.80% 1.01% 0.00% NA
Indica II  465 96.60% 0.00% 2.80% 0.65% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 95.70% 3.40% 0.89% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724905355 C -> DEL LOC_Os07g41550.1 N frameshift_variant Average:69.048; most accessible tissue: Zhenshan97 panicle, score: 91.374 N N N N
vg0724905355 C -> T LOC_Os07g41550.1 missense_variant ; p.Gly118Arg; MODERATE nonsynonymous_codon ; G118R Average:69.048; most accessible tissue: Zhenshan97 panicle, score: 91.374 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724905355 C T -0.03 0.0 0.0 -0.04 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724905355 1.59E-06 NA Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0724905355 NA 2.74E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724905355 NA 9.27E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724905355 NA 2.26E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724905355 NA 4.90E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724905355 NA 1.34E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251