Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724265249:

Variant ID: vg0724265249 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 24265249
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CTACTTCACATACCCCCGAGTCCATATCTCCGACAGTAGCCCCCGGCGCTATATCGGATATCGATTTCCTGAGATCGTTCTGACATGGCGCCTCACGACT[T/C]
CTCGAGCTGGGGTTGTGGGCCCGGCAGGGAATCCAAAAGGATATGGCCGCGTGGCCAGGTTGGCGTGCCAACCATAACAACGGTTTGACCGCCACTGACC

Reverse complement sequence

GGTCAGTGGCGGTCAAACCGTTGTTATGGTTGGCACGCCAACCTGGCCACGCGGCCATATCCTTTTGGATTCCCTGCCGGGCCCACAACCCCAGCTCGAG[A/G]
AGTCGTGAGGCGCCATGTCAGAACGATCTCAGGAAATCGATATCCGATATAGCGCCGGGGGCTACTGTCGGAGATATGGACTCGGGGGTATGTGAAGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 14.60% 3.51% 0.30% NA
All Indica  2759 93.70% 0.90% 4.93% 0.51% NA
All Japonica  1512 56.90% 43.10% 0.07% 0.00% NA
Aus  269 92.90% 0.00% 7.06% 0.00% NA
Indica I  595 98.80% 0.70% 0.50% 0.00% NA
Indica II  465 88.20% 3.00% 8.17% 0.65% NA
Indica III  913 90.50% 0.10% 8.32% 1.10% NA
Indica Intermediate  786 96.80% 0.60% 2.42% 0.13% NA
Temperate Japonica  767 19.20% 80.70% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 77.80% 15.60% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0724265249 T -> DEL N N silent_mutation Average:74.497; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N
vg0724265249 T -> C LOC_Os07g40490.1 downstream_gene_variant ; 3839.0bp to feature; MODIFIER silent_mutation Average:74.497; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N
vg0724265249 T -> C LOC_Os07g40510.1 downstream_gene_variant ; 1227.0bp to feature; MODIFIER silent_mutation Average:74.497; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N
vg0724265249 T -> C LOC_Os07g40490-LOC_Os07g40510 intergenic_region ; MODIFIER silent_mutation Average:74.497; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0724265249 T C 0.0 0.0 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0724265249 7.20E-07 3.41E-17 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 1.60E-09 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 2.73E-13 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 1.02E-07 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 6.46E-06 1.51E-15 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 2.22E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 5.43E-12 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 3.45E-07 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 6.54E-07 6.53E-07 mr1703 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 2.19E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 7.89E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 6.74E-07 1.46E-18 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 8.29E-11 mr1182_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 2.96E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 8.70E-08 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 5.47E-07 NA mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 1.96E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 4.20E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724265249 NA 8.50E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251