| Variant ID: vg0724068092 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 24068092 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )
AAAAAATAATAACTTCCTCATGTACGAATGAGTTTGCACGTTACAAATGCCACTGCTTTCTTTCCGTACGTACAAACGTTGTACATGATTGAAAACAAAA[T/C]
TTTCCTAATCTTCGCTGGAAGAAAAAACATATACATGTACATAAAACAGACAGAAAAAACATACATTCAAATATGAATTTCTACAATATAAAGATAAAAT
ATTTTATCTTTATATTGTAGAAATTCATATTTGAATGTATGTTTTTTCTGTCTGTTTTATGTACATGTATATGTTTTTTCTTCCAGCGAAGATTAGGAAA[A/G]
TTTTGTTTTCAATCATGTACAACGTTTGTACGTACGGAAAGAAAGCAGTGGCATTTGTAACGTGCAAACTCATTCGTACATGAGGAAGTTATTATTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 36.50% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 93.40% | 6.40% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.30% | 9.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.90% | 5.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.90% | 87.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 60.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0724068092 | T -> C | LOC_Os07g40100.1 | upstream_gene_variant ; 449.0bp to feature; MODIFIER | silent_mutation | Average:36.79; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0724068092 | T -> C | LOC_Os07g40120.1 | upstream_gene_variant ; 3089.0bp to feature; MODIFIER | silent_mutation | Average:36.79; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0724068092 | T -> C | LOC_Os07g40110.1 | downstream_gene_variant ; 1972.0bp to feature; MODIFIER | silent_mutation | Average:36.79; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0724068092 | T -> C | LOC_Os07g40100-LOC_Os07g40110 | intergenic_region ; MODIFIER | silent_mutation | Average:36.79; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0724068092 | NA | 2.62E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724068092 | NA | 1.48E-06 | mr1274 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724068092 | NA | 8.14E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724068092 | 1.78E-06 | 1.78E-06 | mr1169_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0724068092 | NA | 5.37E-06 | mr1219_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |