Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723741534:

Variant ID: vg0723741534 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23741534
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAAAAAAAAAAGGTCAGCTCGATCTTTAGTCCCGGTTGGTAGATGGCTCAGCCGGTCACGTGGCTGAGCCATCTTTAGTCCCGGTTGGTGTGGTGTTA[C/T]
CAACCGAGACTAAAGATCGATCTTTAGTCCCAGTTATTTCACCCGGGACTAAAGATAGCGATCTTTAGTCCTGGATTGGTAGTCCTGGTTTTCAAACCAG

Reverse complement sequence

CTGGTTTGAAAACCAGGACTACCAATCCAGGACTAAAGATCGCTATCTTTAGTCCCGGGTGAAATAACTGGGACTAAAGATCGATCTTTAGTCTCGGTTG[G/A]
TAACACCACACCAACCGGGACTAAAGATGGCTCAGCCACGTGACCGGCTGAGCCATCTACCAACCGGGACTAAAGATCGAGCTGACCTTTTTTTTTTGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	10.70%	1.38%	0.00%	NA
All Indica	2759	95.30%	3.80%	0.94%	0.00%	NA
All Japonica	1512	72.10%	25.50%	2.38%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.60%	3.20%	1.18%	0.00%	NA
Indica II	465	94.60%	5.20%	0.22%	0.00%	NA
Indica III	913	99.30%	0.50%	0.11%	0.00%	NA
Indica Intermediate	786	90.60%	7.30%	2.16%	0.00%	NA
Temperate Japonica	767	82.50%	14.10%	3.39%	0.00%	NA
Tropical Japonica	504	55.40%	42.70%	1.98%	0.00%	NA
Japonica Intermediate	241	73.90%	26.10%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723741534	C -> T	LOC_Os07g39620.1	upstream_gene_variant ; 4922.0bp to feature; MODIFIER	silent_mutation	Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0723741534	C -> T	LOC_Os07g39610.1	downstream_gene_variant ; 545.0bp to feature; MODIFIER	silent_mutation	Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0723741534	C -> T	LOC_Os07g39610-LOC_Os07g39620	intergenic_region ; MODIFIER	silent_mutation	Average:38.872; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723741534	NA	4.90E-06	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	NA	1.29E-06	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	NA	5.14E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	NA	4.82E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	NA	8.93E-07	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	NA	8.73E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	NA	2.89E-13	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723741534	3.68E-06	1.42E-10	mr1980_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251