Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723664033:

Variant ID: vg0723664033 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 23664033
Reference Allele: ATG	Alternative Allele: CTG,A
Primary Allele: CTG	Secondary Allele: ATG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTATAACACGTAGTACGTGTGGTACGCATGTTGAAGCGTTTTTTAACTTCCGCATATTCGAAGTACCAAAACACTCTACCTCACTTCCTTATACTCCCT[ATG/CTG,A]
TTCCAAAATATAAGGCACAACCAACCTTAACCCAAAGACTAAGAAACAATTATTATCATCTACTAGTTTGAATCATCATAATAAATATAATGCATGCATC

Reverse complement sequence

GATGCATGCATTATATTTATTATGATGATTCAAACTAGTAGATGATAATAATTGTTTCTTAGTCTTTGGGTTAAGGTTGGTTGTGCCTTATATTTTGGAA[CAT/CAG,T]
AGGGAGTATAAGGAAGTGAGGTAGAGTGTTTTGGTACTTCGAATATGCGGAAGTTAAAAAACGCTTCAACATGCGTACCACACGTACTACGTGTTATAAT

Allele Frequencies:

Populations	Population Size	Frequency of CTG(primary allele)	Frequency of ATG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	33.50%	0.32%	0.02%	A: 0.04%
All Indica	2759	92.60%	7.00%	0.33%	0.04%	NA
All Japonica	1512	22.60%	77.40%	0.00%	0.00%	NA
Aus	269	42.80%	57.20%	0.00%	0.00%	NA
Indica I	595	95.10%	4.50%	0.34%	0.00%	NA
Indica II	465	90.10%	9.20%	0.43%	0.22%	NA
Indica III	913	98.60%	1.10%	0.33%	0.00%	NA
Indica Intermediate	786	85.40%	14.40%	0.25%	0.00%	NA
Temperate Japonica	767	10.20%	89.80%	0.00%	0.00%	NA
Tropical Japonica	504	30.00%	70.00%	0.00%	0.00%	NA
Japonica Intermediate	241	46.50%	53.50%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	45.60%	45.60%	6.67%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723664033	ATG -> DEL	N	N	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> CTG	LOC_Os07g39480.1	upstream_gene_variant ; 4408.0bp to feature; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> CTG	LOC_Os07g39490.1	upstream_gene_variant ; 991.0bp to feature; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> CTG	LOC_Os07g39500.1	downstream_gene_variant ; 4088.0bp to feature; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> CTG	LOC_Os07g39480-LOC_Os07g39490	intergenic_region ; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> A	LOC_Os07g39480.1	upstream_gene_variant ; 4409.0bp to feature; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> A	LOC_Os07g39490.1	upstream_gene_variant ; 990.0bp to feature; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> A	LOC_Os07g39500.1	downstream_gene_variant ; 4087.0bp to feature; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N
vg0723664033	ATG -> A	LOC_Os07g39480-LOC_Os07g39490	intergenic_region ; MODIFIER	silent_mutation	Average:59.354; most accessible tissue: Callus, score: 83.666	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723664033	NA	1.67E-06	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723664033	NA	6.81E-07	mr1092_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723664033	NA	4.40E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723664033	NA	2.50E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723664033	NA	2.27E-10	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723664033	NA	1.76E-08	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251