Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0723191618:

Variant ID: vg0723191618 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 23191618
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, T: 0.27, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TTACTACTTACTACTTCCTCCGTCCCATAATATAAGGGATTTTGAGTTTTTGCTTATACTGTTTGATCACTCGTATTATTAAAAAAATTTGTGCAAATAT[A/T]
AAAAACGAAAAGTTGTGATTAAAGTACTTTGGATAATAAAATAAGTCACAAAAAATAAATAATAATTTCAAAAACTTTTGAATAAGACGAGTGGCCAAAC

Reverse complement sequence

GTTTGGCCACTCGTCTTATTCAAAAGTTTTTGAAATTATTATTTATTTTTTGTGACTTATTTTATTATCCAAAGTACTTTAATCACAACTTTTCGTTTTT[T/A]
ATATTTGCACAAATTTTTTTAATAATACGAGTGATCAAACAGTATAAGCAAAAACTCAAAATCCCTTATATTATGGGACGGAGGAAGTAGTAAGTAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	48.30%	0.38%	0.00%	NA
All Indica	2759	74.00%	25.50%	0.43%	0.00%	NA
All Japonica	1512	5.90%	93.90%	0.20%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	94.80%	4.90%	0.34%	0.00%	NA
Indica II	465	65.80%	33.80%	0.43%	0.00%	NA
Indica III	913	67.10%	32.40%	0.44%	0.00%	NA
Indica Intermediate	786	71.20%	28.20%	0.51%	0.00%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	13.70%	86.10%	0.20%	0.00%	NA
Japonica Intermediate	241	6.20%	93.40%	0.41%	0.00%	NA
VI/Aromatic	96	0.00%	99.00%	1.04%	0.00%	NA
Intermediate	90	30.00%	67.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0723191618	A -> T	LOC_Os07g38600.1	upstream_gene_variant ; 4678.0bp to feature; MODIFIER	silent_mutation	Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg0723191618	A -> T	LOC_Os07g38620.1	downstream_gene_variant ; 2585.0bp to feature; MODIFIER	silent_mutation	Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N
vg0723191618	A -> T	LOC_Os07g38610.1	intron_variant ; MODIFIER	silent_mutation	Average:47.199; most accessible tissue: Zhenshan97 flower, score: 62.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0723191618	NA	5.25E-07	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	NA	6.55E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	NA	2.49E-09	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	NA	3.75E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	NA	4.11E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	9.58E-07	NA	mr1377	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	5.25E-06	5.25E-06	mr1377	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	NA	7.25E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0723191618	NA	6.69E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251